May 07, 2025
Multi-pathogen detection & quantification using digital PCR
- Victor Mabasa1,
- Natasha Singh1,
- Emmanuel Phalane1,
- Sipho Gwala1,
- Mokgaetji Macheke1,
- Nkosenhle Ndlovu1,
- Said Rachida1,
- Kerrigan McCarthy1,2,
- Mukhlid Yousif1,2
- 1National Institute for Communicable Diseases;
- 2University of Witwatersrand
- Wastewater Genomics Syndicate
Protocol Citation: Victor Mabasa, Natasha Singh, Emmanuel Phalane, Sipho Gwala, Mokgaetji Macheke, Nkosenhle Ndlovu, Said Rachida, Kerrigan McCarthy, Mukhlid Yousif 2025. Multi-pathogen detection & quantification using digital PCR. protocols.io https://dx.doi.org/10.17504/protocols.io.261ge87oog47/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: May 06, 2025
Last Modified: May 07, 2025
Protocol Integer ID: 217778
Keywords: dPCR assay, wastewater, wastewater genomics, South Africa, NICD
Disclaimer
Parts of this protocol are derived from the QIAcuity OneStep Advanced Probe Kit User Manual.
Abstract
This protocol is optimised for quantifying RNA and DNA targets using the QIAcuity OneStep Advanced Probe Kit with hydrolysis probes in singleplex or multiplex (up to two targets) reactions on QIAGEN’s QIAcuity digital PCR (dPCR) instruments. It also includes instructions for preparing in-house 20× primer–probe assays.
Materials
1.5 mL Eppendorf tubes
Standard 96-well plate
Microseal Adhesive Seal
QIAcuity 8.5K, 96-well Nanoplate
Pipettes of different sizes
Multichannel pipettes
QIAcuity OneStep Advanced Probe Kit
Before start
- Refer to the QIAcuity User Manual and QIAcuity User Manual Extension for guidance on assay design and experimental setup for the QIAcuity platform.
- The QIAcuity OneStep Advanced Probe Kit has been specially formulated with a hot-start RT enzyme, allowing users to assemble reactions at room temperature
- The Enhancer GC is recommended for use with all Applied Biosystems TaqMan assays, amplicons >150 bp in length, GC-rich amplicons, and RNA targets containing challenging secondary structures.
Assay set-up in a clean-room
Assay set-up in a clean-room
Place the following on ice to thaw:
- 100x OneStep Advanced Reverse Transcription Mix,
- 4x QIAcuity OneStep Advanced Probe Master Mix
- Template RNA
- Primer-probe Mix
- Enhancer GC
- RNase-Free Water
Vigorously mix the individual solutions and centrifuge the tubes briefly to settle the liquids
Using the calculations in Table 1, prepare a master mix in a clean 1.5 mL Eppendorf tube. Remember to add 10% of each component to account for pipetting errors.
Table 1: Assay composition
| Component | x1 sample | x? samples | Final concentration | |
| 4x OneStep Advanced Probe Master Mix | 3 µL | µL | 1x | |
| 100x OneStep Advanced RT Mix | 0.12 µL | µL | 1x | |
| 20x primer-probe mix 1 | 0.6 µL | µL | 0.4 µM forward primer 0.4 µM reverse primer 0.2 µM probe | |
| 20x primer-probe mix 2* (for multiplex) | 0.6 µL | µL | 0.4 µM forward primer 0.4 µM reverse primer 0.2 probe | |
| Enhancer GC | 1 µL | µL | - | |
| Total reaction volume | 5.32 µL | µL | - |
? = number of samples + controls + 10%, * = substitute with RNase-Free water for singleplex assay
Vortex the reaction mix thoroughly and briefly centrifuge. Dispense 5.32 μL of the reaction mix into each well of a standard 96-well PCR pre-plate (according to your experiment layout).
Note
The pre-plate may be assembled at room temperature.
Add nucleic acids in PCR-room
Add nucleic acids in PCR-room
Add 8 µL template RNA to wells containing the reaction mix. Thoroughly mix the template RNA with the reaction mix by pipetting up and down.
Seal the pre-plate with a microseal adhesive suitable for standard 96-well plates and briefly centrifuge (1000 rpm for 30 seconds) to collect any droplets.
Transfer 13.32 μL from each well of the pre-plate to a 96-well QIAcuity Nanoplate, taking care to avoid introducing bubbles.
Note
Always place the Nanoplate on a Nanoplate Tray when handling to protect the sensitive imaging surface at the bottom. Do not place the Nanoplate on ice at any time—work at room temperature.
Seal the Nanoplate with the seal provided in the kit, load it into the QIAcuity instrument, and initiate the one-step RT-dPCR cycling program below.
Note
This cycling program works for all* different primer-probe combinations, despite their different melting temperatures. This is possible because of
QIAcuity RT-dPCR cycling program
QIAcuity RT-dPCR cycling program
Table 2: QIAcuity RT-dPCR cycling program
| Step | Time | Temperature | |
| Reverse Transcription | 40 min | 50°C | |
| RT Enzyme Inactivation | 2 min | 95°C | |
| 2-step cycling (45 cycles) | - | - | |
| Denaturation | 5 sec | 95°C | |
| Combined annealing & Extension | 1 min | 60°C |
Preparing in-house 20x primer-probe assay
Preparing in-house 20x primer-probe assay
If you choose not to purchase QIAcuity pathogen detection assays from QIAGEN, you may source your own primers and probes and prepare them as 100 μM stock solutions.
Thaw your primers and probe on ice and prepare a 20x assay as indicated in Table 3 below.
Table 3: Preparing 20x primer-probe assays
| Component | Final Conc. in 20x assay | Volume to add | |
| Forward primer (100 μM) | 8 μM | 8 μL | |
| Reverse primer (100 μM) | 8 μM | 8 μL | |
| Probe (100 μM) | 4 μM | 4 μL | |
| Nuclease-free water | - | 80 μL | |
| Total | - | 100 μL |
Our working assays
Our working assays
All primers and probes are sourced from IDT through Whitehead Scientific. The reporters, internal quenchers, and 3′-end quenchers used in the assays below may be proprietary to IDT. When designing assays, carefully consider the compatibility of the selected reporters and quenchers, and exercise particular caution when planning multiplex assays to avoid cross-reactivity between chemistries.
Influenza A assay
| Primer/probe | Sequence (5'-3') | |
| InfA For1 | CAAGACCAATCYTGTCACCTCTGAC | |
| InfA Rev1 | GCATTYTGGACAAAVCGTCTACG | |
| InfA Probe | /56-FAM/TGCAGTCCT/ZEN/CGCTCACTGGGCACG/3IABkFQ/ |
Research Use Only CDC Influenza SARS-CoV-2 (Flu SC2) Multiplex Assay Primers and Probes
Influenza B assay
| Primer/probe | Sequence (5'-3') | |
| InfB For | TCCTCAAYTCACTCTTCGAGCG | |
| InfB Rev | CGGTGCTCTTGACCAAATTGG | |
| InfB Probe | /5YakYel/CCAATTCGA/ZEN/GCAGCTGAAACTGCGGTG/3IABkFQ/ |
Research Use Only CDC Influenza SARS-CoV-2 (Flu SC2) Multiplex Assay Primers and Probes
Pan-measles assay
| Primer/probe | Sequence (5'-3') | |
| MVN1139F | TGGCATCTGAACTCGGTATCAC | |
| MVN1213R | TGTCCTCAGTAGTATGCATTGCAA | |
| MVNP1163Probe-2 | /56-TAMN/CCGAGGATGCAAGGCTTGTTTCAGA/3BHQ_1/ |
Hummel, K.B., Lowe, L., Bellini, W.J. and Rota, P.A., 2006. Development of quantitative gene-specific real-time RT-PCR assays for the detection of measles virus in clinical specimens. Journal of virological methods, 132(1-2), pp.166-173.
Measles vaccine strain assay
| Primer/probe | Sequence (5'-3') | |
| VMA168F | GAGATTGGGGGGCAAGGAAGAT | |
| VMA242R | GCATCACTTGCTCTGCTGGGCC | |
| VMA190P | FAM-AGGAGGGTC/BMN-Q535/AAACAGAGTCGA-MGB |
Ndlovu, N., Mabasa, V., Sankar, C., Msomi, N., Phalane, E., Singh, N., Gwala, S., Els, F., Macheke, M., Maposa, S. and Yousif, M., 2024. Wastewater testing during the South African 2022-2023 measles outbreak demonstrates the potential of environmental surveillance to support measles elimination. medRxiv, pp.2024-09.
Rubella assay
| Primer/probe | Sequence (5'-3') | |
| RV98 | GGCAGTTGGGTAAGAGACCA | |
| RV251r | CGTGGAGTGCTGGGTGAT | |
| RV159rp | /5Cy5/ACATCGCGCACTTCCCACG/3IAbRQSp/ |
World Health Organization, 2007. Manual for the laboratory diagnosis of measles and rubella virus infection. In Manual for the laboratory diagnosis of measles and rubella virus infection.
Hepatitis A assay
| Primer/probe | Sequence (5'-3') | |
| HAV-68-F | TCACCGCCGTTTGCCTAG | |
| HAV-240-R | GGAGAGCCCTGGAAGAAAG | |
| HAV-150-Probe | /56-FAM/TTAATTCCT/ZEN/GCAGGTTCAGG/3IABkFQ/ |
Costafreda, M.I., Bosch, A. and Pintó, R.M., 2006. Development, evaluation, and standardization of a real-time TaqMan reverse transcription-PCR assay for quantification of hepatitis A virus in clinical and shellfish samples. Applied and environmental microbiology, 72(6), pp.3846-3855.
Hepatitis E assay
| Primer/probe | Sequence (5'-3') | |
| JVHEVF | GGTGGTTTCTGGGGTGAC | |
| JVHEVR | AGGGGTTGGTTGGATGA A | |
| JVHEVPmod-2 | /5TexRd-XN/TGATTCTCAGCCCTTCGC/3IAbRQSp/ |
Jothikumar, N., Cromeans, T.L., Robertson, B.H., Meng, X.J. and Hill, V.R., 2006. A broadly reactive one-step real-time RT-PCR assay for rapid and sensitive detection of hepatitis E virus. Journal of virological methods, 131(1), pp.65-71.
Mpox generic assay
| Primer/probe | Sequence (5'-3') | |
| N3R-F | TCCAATTATGACCTTTGATGGAA | |
| N3R-R | TGTTTAATTGTAGGACGGTTGT | |
| N3R-P | /56-FAM/TCCATCTAT/ZEN/CTCGTTCATGGTCGGT/3IABkFQ/ | |
| B18R-F | TGGTTGCCGGATCTACGTATT | |
| B18R-R | ACGTTCTTAGTCGGTGCATT | |
| B18R-P | /5Cy5/CTAGTTGCTAGATCTCTCGCTATCATAG/3BHQ-3/ |
Fan, Z., Xie, Y., Huang, B., Zhao, F., Hu, Y., Huang, Y., Mei, S., Wei, L., Wang, L., Wang, L. and Gao, Z., 2024. Development of a multiplex real-time PCR assay for the simultaneous detection of mpox virus and orthopoxvirus infections. Journal of Virological Methods, 328, p.114957.
Mycobacterium complex assay (IS6110)
| Primer/probe | Sequence (5'-3') | |
| TB_For | TCCACGGCCTGGGCTACCA | |
| TB_Rev | CATCGCGCACGCATCGGG | |
| TB_Probe | /56-ROXN/CACTCCGCCGATCGTTTTTCC/3IABkFQ/ |
Mycobacterium tuberculosis assay (Glycosyltransferase)
| Primer/probe | Sequence (5'-3') | |
| Forward | TCCACGGCCTGGGCTACCA | |
| Reverse | CATCGCGCACGCATCGGG | |
| Probe | /56-ROXN/CACTCCGCCGATCGTTTTTCC/3IABkFQ/ |
Park, J., Kwak, N., Chae, J.C., Yoon, E.J. and Jeong, S.H., 2023. A two-step real-time PCR method To identify Mycobacterium tuberculosis infections and six dominant nontuberculous mycobacterial infections from clinical specimens. Microbiology spectrum, 11(4), pp.e01606-23.
Assays ordered ready-made from Qiagen
| Assay name | GeneGlobe ID | Reporter | |
| SARS-CoV-2 (N1) | DMA00710 | ROX | |
| Vibrio Cholerae | DMA00340 | TAMRA | |
| Dengue virus (pan) | DMA00788 | FAM | |
| Hepatitis B | DMA00808 | FAM |
Protocol references
This protocol is derived from the QIAcuity OneStep Advanced Probe Kit User Manual.
Fan, Z., Xie, Y., Huang, B., Zhao, F., Hu, Y., Huang, Y., Mei, S., Wei, L., Wang, L., Wang, L. and Gao, Z., 2024. Development of a multiplex real-time PCR assay for the simultaneous detection of mpox virus and orthopoxvirus infections. Journal of Virological Methods, 328, p.114957.
Jothikumar, N., Cromeans, T.L., Robertson, B.H., Meng, X.J. and Hill, V.R., 2006. A broadly reactive one-step real-time RT-PCR assay for rapid and sensitive detection of hepatitis E virus. Journal of virological methods, 131(1), pp.65-71.
Costafreda, M.I., Bosch, A. and Pintó, R.M., 2006. Development, evaluation, and standardization of a real-time TaqMan reverse transcription-PCR assay for quantification of hepatitis A virus in clinical and shellfish samples. Applied and environmental microbiology, 72(6), pp.3846-3855.
Hummel, K.B., Lowe, L., Bellini, W.J. and Rota, P.A., 2006. Development of quantitative gene-specific real-time RT-PCR assays for the detection of measles virus in clinical specimens. Journal of virological methods, 132(1-2), pp.166-173.
World Health Organization, 2007. Manual for the laboratory diagnosis of measles and rubella virus infection. In Manual for the laboratory diagnosis of measles and rubella virus infection.
Research Use Only CDC Influenza SARS-CoV-2 (Flu SC2) Multiplex Assay Primers and Probes.
Ndlovu, N., Mabasa, V., Sankar, C., Msomi, N., Phalane, E., Singh, N., Gwala, S., Els, F., Macheke, M., Maposa, S. and Yousif, M., 2024. Wastewater testing during the South African 2022-2023 measles outbreak demonstrates the potential of environmental surveillance to support measles elimination. medRxiv, pp.2024-09.
Park, J., Kwak, N., Chae, J.C., Yoon, E.J. and Jeong, S.H., 2023. A two-step real-time PCR method To identify Mycobacterium tuberculosis infections and six dominant nontuberculous mycobacterial infections from clinical specimens. Microbiology spectrum, 11(4), pp.e01606-23.