MPRA plasmid pool preparation

Gerald Raffl; Boyan Bonev

Nov 30, 2021

MPRA plasmid pool preparation

Nature Cell Biology

DOI

dx.doi.org/10.17504/protocols.io.8epv5zp8nv1b/v1

Gerald Raffl¹,
Boyan Bonev¹

¹Helmholtz Pioneer Campus

Boyan Bonev

Helmholtz Pioneer Campus

DOI: dx.doi.org/10.17504/protocols.io.8epv5zp8nv1b/v1

External link: https://doi.org/10.1038/s41556-023-01296-5

Protocol Citation: Gerald Raffl, Boyan Bonev 2021. MPRA plasmid pool preparation. protocols.io https://dx.doi.org/10.17504/protocols.io.8epv5zp8nv1b/v1

Manuscript citation:

Noack, F., Vangelisti, S., Ditzer, N. et al. Joint epigenome profiling reveals cell-type-specific gene regulatory programmes in human cortical organoids. Nat Cell Biol 25, 1873–1883 (2023). https://doi.org/10.1038/s41556-023-01296-5

License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited

Protocol status: Working

We use this protocol and it’s working

Created: August 13, 2021

Last Modified: November 30, 2021

Protocol Integer ID: 52329

Abstract

Protocol to generate the MPRA plasmid pool.

Materials

Devices:
Microwave
Blue light illuminator
Centrifuge
Thermal Cycler
Magnet for magnetic bead purifications
Electrophoresis station
Nanodrop 
Electroporator


Reagents:
CRE library as single stranded oligos, lyophilized
Nuclease free water (Ambion Invitrogen, Cat. N: AM9937)
NEBNext® Ultra™ II Q5® Master Mix (NEB, Cat. N: M0544)
Eppendorf PCR tubes, 0.2 mL (Eppendorf, Cat. N: 30124359)
DNA LoBind® Tubes, 1.5 mL (Eppendorf, Cat. N: 30108051)
AMPure XP (Beckman Coulter, Cat. N: A63881)
Agarose
TAE Buffer (Tris-acetate-EDTA) (50X) (ThermoFisher Scientific, Cat. N: 10399519)
SYBR™ Safe DNA Gel Stain (ThermoFisher Scientific, Cat. N: S33102)
Quick-Load® Purple 1 kb Plus DNA Ladder (NEB, Cat. N: N0550)
Zymoclean Gel DNA Recovery Kit (Zymo Resarch, Cat. N: D4007)
DNA Clean & Concentrator Kit (Zymo Research, Cat. N: D4014)
Q5® Hot Start High-Fidelity 2X Master Mix (NEB, Cat. N: M0494)
NEBuilder® HiFi DNA Assembly Master Mix (NEB, Cat. N: E2621)
ElectroMAX™ Stbl4™ Competent Cells (ThermoFisher Scientific, 11635018)
Gene Pulser/MicroPulser Electroporation Cuvettes, 0.1 cm gap (BioRad; Cat. N: 1652083)
LB medium, sterile
~30 LB agar plates (10 cm diameter) + 100 µg/mL Carbenicillin
10 LB agar plates (15 cm diameter) + 100 µg/mL Carbenicillin
QIAprep Spin Miniprep Kit (Qiagen, Cat. N: 27106)
KpnI-HF® (NEB, Cat. N: R3142)
SpeI-HF® (NEB, Cat. N: R3133)
EcoRI-HF® (NEB, Cat. N: R3101)
BamHI-HF® (NEB, Cat. N: R3136)
T4 DNA ligase (NEB, Cat. N: M0202)
EndoFree Plasmid Maxi Kit (Qiagen, Cat. N: 12362)


Primers:
namesequence
pool_amp_FAGGACCGGATCAACT
pool_amp_RTCGGTTCACGCAATG
CRS_pMPRA1-GibOH_FTGCCAGAACATTTCTCTGGCCTAACTGGCCAGGACCGGATCAACT
CRS_GibOH_uniRV_BC12_RCCGACTAGCTTGGCCGCCGAGGCCGACGCTCTTCCGATCTGNNNNNNNNNNNNGAATTCATCTGGTACCTCGGTTCACGCAATG
pMPRA1_BB_FTCGGCGGCCAAGCTAGTC
pMPRA1_BB_RCAGTTAGGCCAGAGAAATGTTCTGG
RVprimer3(pMPRA1)_FCTAGCAAAATAGGCTGTCCC
EBV-rev(pMPRA1)_RGTGGTTTGTCCAAACTCATC

PCR amplification of oligos

Design of single stranded oligo library:
5'-AGGACCGGATCAACT**CRE_270bp**CATTGCGTGAACCGA-3'

Resuspend the single stranded oligos in nuclease free water to obtain a concentration of 20 ng/µL.

To transform the single stranded oligos into double stranded DNA, set up the following PCR reaction:
µL single stranded oligos 
µL primer pool_amp_F (10µM stock)
µL primer pool_amp_R (10µM stock)
µL NEBNext Ultra II Q5 Master Mix
µL nuclease free water
Split the reaction mix into 4 PCR tubes to avoid PCR jackpotting.

Incubate in a PCR cycler with heated lid:
30s - 98°C
8 cycles (10s - 98°C; 20s - 60°C; 30s - 72°C)
5min - 72°C
hold - 4°C

15m

Combine the reaction mix from the 4 PCR tubes in a DNA low binding 1.5 tube. Clean up the PCR product with 1.8X vol. of AMPure XP magnetic beads following the manufacturer's protocol.
Elute the PCR product in 21 µL nuclease free water.

Determine the DNA concentration by measuring 1 µL on the Nanodrop.

Gibson overhangs and a 12bp barcode are added by PCR.
Set up the following PCR reaction:
variable: 25 ng PCR product from step Go togo to step #5   
5 µL primer CRS_pMPRA1-GibOH_F (10µM stock)
5 µL primer CRS_GibOH_uniRV_BC12_R (10µM stock)
50 µL NEBNext Ultra II Q5 Master Mix
to 100 µL: nuclease free water
Split the reaction mix into 4 PCR tubes to avoid PCR jackpotting.

Incubate in a PCR cycler with heated lid:
30s - 98°C
14 cycles (10s - 98°C; 20s - 60°C; 30s - 72°C)
5min - 72°C
hold - 4°C

30m

Combine the reaction mix from the 4 PCR tubes and add 20 µL 6X gel loading dye. Perform DNA gel electrophoresis (30 min, 100 V) on a gel made of 1 % agarose in 1X TAE, with 1:30'000 SYBR Safe stain. Cut the band(s) at 399 bp using a blue light illuminator.

40m

Extract DNA from the agarose by using the Zymoclean Gel DNA Recovery Kit and following the manufacturer's protocol. Elute in 20 µL nuclease free water. 

15m

Repurify the product using the DNA Clean & Concentrator Kit (binding buffer ratio 5:1) and following the manufacturer's protocol. Elute in 12 µL nuclease free water. 

10m

Determine the DNA concentration by measuring 1 µL on the Nanodrop.
This is the insert library for the subsequent Gibson assembly. Freeze at -20°C until use.

Amplification of the backbone

To obtain more backbone, multiple reactions can be set up in parallel.
Set up the following PCR reaction:
1 ng pMPRA1 (addgene #49349)
2.5 µL pMPRA1_BB_F (10µM stock)
2.5 µL pMPRA1_BB_R (10µM stock)
25 µL Q5 Hot Start High-Fidelity 2X Master Mix
to 50 µL: nuclease free water

Incubate in a PCR cycler with heated  lid:
30s - 98°C
35 cycles (10s - 98°C; 20s - 68°C; 1min - 72°C)
5min - 72°C
hold - 4°C

Perform DNA gel electrophoresis and DNA gel extraction (band at 2499bp) as described in steps Go togo to step #9   - Go togo to step #10   . Elute in 20 µL nuclease free water.

Determine DNA concentration by measuring 1 µL on the Nanodrop.
This is the backbone for the subsequent Gibson assembly. Freeze at -20°C until use.

Gibson assembly

Preheat a PCR cycler to 50°C, with lid temperature ≥ 75°C

Set up a Gibson assembly reaction in a PCR tube:
1 µg backbone from step Go togo to step #16   
2:1 molar ratio (~ 320 ng) insert from step Go togo to step #12   
to 50 µL: nuclease free water

Add 50 µL NEBuilder HiFi DNA Assembly Master Mix, mix briefly by pipetting up and down and immediately transfer reaction to the PCR cycler at 50°C.
Incubate for 1h at 50°C

Purify the product using the DNA Clean & Concentrator Kit (binding buffer ratio 2:1) and following the manufacturer's protocol. Elute in 9 µL nuclease free water. 

Determine DNA concentration by measuring 1 µL on the Nanodrop.
Ideally, continue with electrotransformation straight away.

Electrotransformation & MPRA pre-pool preparation

30m

Prewarm 1 mL SOC medium, ideally to 37°C.
Keep a 1.5 mL Eppendorf tube warm.
Thaw a vial (100 µL) of ElectroMAX Stbl4 Competent Cells on ice.
Precool four electroporation cuvettes on ice.

Set electroporator to the following parameters:
8 kV
μF
Ω

Mix bacteria with 400 ng of purified Gibson assembly product from step Go togo to step #21   .
Distribute bacteria to the 4 cuvettes (25 µL each), while keeping them on ice.

Electroporate each cuvette with parameters set in step Go togo to step #23    and immediately add 200 µL warm SOC medium.

Combine the 4 reactions in the 1.5 mL Eppendorf tube. 
Shake the electrotransformed bacteria for 30min at 37°C and 200 rpm.

30m

In the meantime, prewarm 24 LB-agar plates (10 cm diameter) with 100 µg/mL Carbenicillin to 37°C.

Vortex bacteria thoroughly and prepare the following 2 conditions:
condition A: 700 µL bacteria + 800 µL warm LB medium
condition B:  70 µL bacteria + 1430 µL warm LB medium

From both conditions, prepare dilutions for counting plates:
1:1K dilution (7 µL bacteria + 693 µL warm LB medium)
1:10K dilution (70 µL bacteria [1:1K dilution] + 630 µL warm LB medium)
When plating 140 µL, the counting plate has 1'000 times / 10'000 times less colonies than all 10 plates of a certain condition combined.

For each condition:
Plate 140 µL for both counting plates
Plate 140 µL bacteria mix from step Go togo to step #28   on 10 plates.

Label all plates and incubate them at 37°C overnight (min. 16h).

16h

Count colonies on counting plates and calculate the number of transformants for each condition. If there is too many colonies, count a quarter of the plate and multiply the count by 4.
Note
e.g. 
560 colonies on 1:10'000 dilution & 5200 colonies on 1:1'000 dilution 
=> ~ 5.4mio. colonies distributed on 10 plates of this condition

Don't trash the counting plates yet.

Depending on the number of CREs in the pool, and the desired number of barcodes per CRE; calculate the required colony number using the following formula: 

required colony number = (number of CREs) * (desired number of barcodes per CRE)

Based on the required colony number, choose a condition (undiluted or 1:10 diluted) and scrape the respective number of colonies using cell scrapers and LB medium.

Combine the scraped colonies in one tube and vortex to resuspend. 
Extract plasmid DNA using the QIAprep Spin Miniprep Kit and following the manufacturer's protocol. Depending on the amount of bacteria, split the mixture into multiple reactions.

Determine DNA concentration by measuring 1 µL on the Nanodrop.
Plasmid DNA can be stored at -20°C for months.
This is the MPRA pre-pool which will be used for:
CRE-Barcode-association sequencing
Subsequent cloning: insertion of minimal promoter and reporter gene

To verify the correct identity of the MPRA pre-pool, perform analytical restriction digest with 250 ng of the MPRA pre-pool. 
Set up two separate reactions, following the manufacturer's protocol:
Linearization with KpnI
Cut out CRE insert with KpnI and SpeI

Perform DNA gel electrophoresis as described in step Go togo to step #9   . 
Expected result
Linearization: band at ~2850bp

Backbone: band at ~2300bp; Insert: band at 534bp

To verify the correct identity of individual clones, pick 16 colonies from a counting plate and inoculate overnight cultures (2 mL LB medium with 100 µg/mL Carbenicillin, shaking at 37°C overnight).

Extract plasmid DNA from individual clones using the QIAprep Spin Miniprep Kit and send plasmids for Sanger sequencing using the following primers: RVprimer3(pMPRA1)_F and EBV-rev(pMPRA1)_R
Expected result
Expected Sanger results, polyN represent the 12bp barcode, introduced in step Go togo to step #7   

RVprimer3(pMPRA1)_F:
CTAGCAAAATAGGCTGTCCCCAGTGCAAGTGCAGGTGCCAGAACATTTCTCTGGCCTAACTGGCCAGGACCGGATCAACT***CRE_270bp***CATTGCGTGAACCGAGGTACCAGATGAATTCNNNNNNNNNNNNCAGATCGGAAGAGCGTCGGCCTCGGCGGCCAAGCTAGTCGGGGCGGCCGGCCGCTTCGAGCAGACATGATAAGATACATTGATGAGTTTGGACAAACCAC

EBV-rev(pMPRA1)_R:
GTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGCTCGAAGCGGCCGGCCGCCCCGACTAGCTTGGCCGCCGAGGCCGACGCTCTTCCGATCTGNNNNNNNNNNNNGAATTCATCTGGTACCTCGGTTCACGCAATG***CRE_270bp_revcomp***AGTTGATCCGGTCCTGGCCAGTTAGGCCAGAGAAATGTTCTGGCACCTGCACTTGCACTGGGGACAGCCTATTTTGCTAG

Restriction digest & ligation of MP_mScarlet-I

In this section, the minimal promoter and reporter gene (mScarlet-I) are added to the MPRA pre-pool via restriction cloning.

The plasmid pGR029 (note: also pGR023 and pGR025 - pGR033) contains 
the minimal Promoter (derived from pNL3.1[Nluc/minP], Promega) and 
mScarlet-I (kind gift from the Goetz Lab)
flanked by KpnI and EcoRI restriction sites.

Both pGR029 and the MPRA pre-pool are digested with EcoRI and KpnI. For each reaction, use 5 µg input DNA and 2.5 µL of both enzymes in 50 µL reactions, shaking for 2h at 37°C.

Perform DNA gel electrophoresis on the pGR029 digest as described in step Go togo to step #9   , and cut the relevant band at 779bp.
Note
The MPRA pre-pool does not need to run on the gel, since the 'insert' is just 4 bp long and can be removed by a simple cleanup with the DNA Clean & Concentrator Kit.

Extract DNA from the agarose by using the Zymoclean Gel DNA Recovery Kit and following the manufacturer's protocol. Elute in 20 µL nuclease free water. 

Repurify the gel-extracted product using the DNA Clean & Concentrator Kit (binding buffer ratio 5:1) and following the manufacturer's protocol. Elute in 12 µL nuclease free water. This is the insert for the subsequent ligation reaction.

Purify the restriction digest of the MPRA pre-pool using the DNA Clean & Concentrator Kit, and elute in 12 µL nuclease free water. This is the backbone for the subsequent ligation reaction.

Determine the DNA concentrations by measuring 1 µL on the Nanodrop.
Freeze at -20°C until use.

Set up the following ligation reaction:
2 µg backbone (digested MPRA pre-pool)
2:1 molar ratio of insert (MP_mScarlet-I) => ~ 550 ng
to 175 µL: nuclease free water
20 µL T4 DNA ligase buffer (10X)
5 µL T4 DNA ligase

Incubate in this order: 30min at 4°C, 4h at 16°C and 30min at RT

Purify the ligation product using the DNA Clean & Concentrator Kit (binding buffer ratio 2:1) and following the manufacturer's protocol. Elute in 9 µL nuclease free water. 

Determine DNA concentration by measuring 1 µL on the Nanodrop.

Electrotransformation & MPRA pool preparation

20h

Perform electrotransformation of 100 µL electrocompetent bacteria with 400 ng of purified ligation product as described in Go togo to step #22   - Go togo to step #26   .

In the meantime, prewarm 3 normal LB-agar plates (10 cm diameter) and 10 big LB-agar plates (15 cm diameter) with 100 µg/mL Carbenicillin to 37°C.

Fill the bacterial culture up to 4 mL with LB medium. 

Prepare dilutions for counting plates:
1K:   5 µL bacterial culture + 195 µL LB medium
10K:   20 µL (1:1K dil.) + 180 µL LB medium
100K:   20 µL (1:10K dil.) + 180 µL LB medium

Plate 140 µL from each counting plate dilution on LB-agar plates (10 cm diameter).
Plate 350 µL of the bacterial culture from step Go togo to step #52    on each of the 10 big LB-agar plates (15 cm diameter).

Label all plates and incubate them at 37°C overnight (20h).

20h

Count colonies on counting plates and calculate the number of transformants. If there is too many colonies, count a quarter of the plate and multiply the count by 4.

To preserve library complexity, the number of transformants should exceed the desired library complexity from step Go togo to step #33   .

Scrape all colonies from the 10 big LB-agar plates using cell scrapers and LB medium. Combine the bacteria and vortex thoroughly to resuspend.

Extract plasmid DNA using the EndoFree Plasmid Maxi Kit and following the manufacturer's protocol. In the final step, resuspend the DNA pellet in 1X sterile PBS.

Determine DNA concentration by measuring 1 µL on the Nanodrop.
This is the final MPRA pool. Freeze in aliquots (!) at -20°C. Repeated freeze-thaw cycles are not recommended!

To verify the correct identity of the MPRA pool, perform analytical restriction digest with 250 ng of the MPRA pool. 
Set up two separate reactions, following the manufacturer's protocol:
Linearization with BamHI
BamHI and KpnI

Perform DNA gel electrophoresis as described in step Go togo to step #9   . 
Expected result
Linearization: band at ~3.6kbp
BamHI + KpnI: bands at ~2.5kbp and ~1.1kbp

	name	sequence
	pool_amp_F	AGGACCGGATCAACT
	pool_amp_R	TCGGTTCACGCAATG
	CRS_pMPRA1-GibOH_F	TGCCAGAACATTTCTCTGGCCTAACTGGCCAGGACCGGATCAACT
	CRS_GibOH_uniRV_BC12_R	CCGACTAGCTTGGCCGCCGAGGCCGACGCTCTTCCGATCTGNNNNNNNNNNNNGAATTCATCTGGTACCTCGGTTCACGCAATG
	pMPRA1_BB_F	TCGGCGGCCAAGCTAGTC
	pMPRA1_BB_R	CAGTTAGGCCAGAGAAATGTTCTGG
	RVprimer3(pMPRA1)_F	CTAGCAAAATAGGCTGTCCC
	EBV-rev(pMPRA1)_R	GTGGTTTGTCCAAACTCATC

Public workspaceMPRA plasmid pool preparation

MPRA plasmid pool preparation