Aug 22, 2024

Mouse Tissue mtDNA Copy Number Protocol

  • 1California Institute of Technology;
  • 2Columbia University Irving Medical Center
Icon indicating open access to content
QR code linking to this content
Protocol CitationLivia Hecke Morais, Jack Devine 2024. Mouse Tissue mtDNA Copy Number Protocol. protocols.io https://dx.doi.org/10.17504/protocols.io.14egn6jwzl5d/v1
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: August 09, 2024
Last Modified: August 22, 2024
Protocol  Integer ID: 105075
Keywords: mouse tissue mtdna copy number protocol, mouse
Abstract
Mouse Tissue mtDNA Copy Number Protocol developed in the Picard lab at Departments of Psychiatry and Neurology, Robert N Butler Columbia Aging Center, Columbia University Irving Medical Center, New York, NY, USA
Attachments
Consumables, with catalog numbers:

BD Vacutainer Tubes (BD #363083)
Tris HCl (Sigma #T3253)
Tween 20, 10% (Sigma #P1379)
Nuclease free water (Thermofisher Scientific #AM9939)
Proteinase K (20 mg/mL) (Thermofisher Scientific #AM2548)
Stericup Quick Release-GV Sterile Vacuum Filtration System – 500 mL (Millipore Sigma S2GVU05RE)
BrandTech 96-well semi-skirted plate (BrandTech #781375/VWR #10141-434)
BrandTech 8-strip domed tube caps (BrandTech #781340/VWR #80087-132)
2x TaqMan Universal MasterMix Fast (LifeTech #4444965)
MicroAmp Optical 384-Well Reaction Plate with Barcode (ThermoFisher #4309849) MicroAmp Optical Adhesive Film (ThermoFisher #4311971) Validated mtDNA/nDNA Primer & Probe sequences (idtDNA.com)
Additional consumables not listed here: 1.5 mL Eppendorf tubes, pipette tips as needed.

Lysis buffer for mtDNA measurement
Keep everything sterile. The below calculations provide sufficient lysis buffer for 1 L of complete lysis buffer, or about 5,000 reactions.
Tris-HCl (0.38M, pH 8.5)                                                                                     (Sigma #T3253)
- 18.168 g of Tris HCl (MW = 157.60 g/mol) in 200 mL of nuclease-free dH2O
- pH to 8.5 with 5M NaOH (about 12.5 mL, but measure pH continuously)
- Note: Accurate pH is critical for proper extraction. Make sure your pH meter has been recently calibrated.
- Make up to 300 mL with nuclease-free dH2O
- Sterile filter Tris-HCl buffer using a SteriCup (Make 6 mL or 12 mL aliquots, depending on if you want to run 1 or 2 plates at once)
Tween 20, 10%                                                                                                   (Sigma #P1379)
- 540 mL of ultrapure dH2O
- 60mL of Tween 20 (wash tip thoroughly or leave in solution)
- Sterile filter Tween 10% using a SteriCup (Make 12 mL or 24 mL aliquots, depending on if you want to run 1 or 2 plates at once)
NB: Thawing these 10% Tween aliquots can be slow. I recommend using a 37ºC bead bath.
ddH2O (Sterile, nuclease-free)                                            (Thermofisher Scientific #AM9939)
(Make 5 mL aliquots or use direct from bottle)
Proteinase K (20 mg/mL)                                                     (Thermofisher Scientific #AM2548)
- To be put in fresh from 20 mg/mL                        (1:100 dilution, final 200 µg/mL)
Store aliquots at -30°C
Recipe for 1ml Lysis Buffer
300 µL – Tris HCl
600 µL – Tween 20
90 µL – nuclease free H2O
10 µL – Proteinase K
Examples of Lysis Buffer Calculations (including a bit of excess)
Component 48 Samples 96 Samples (1 plate) 2 Plates
Tris 3 mL 6 mL 12 mL
Tween 6 mL 12 mL 24 mL
Proteinase K 100 µL 200 µL 400 µL
Nuclease-free water 900 µL 1800 µL 3.6 mL
Total Volume 10 mL 20 mL 40 mL
Lysis for Mouse Tissue
  • Thaw all reagents and prepare lysis buffer as described above.
  • Add 180 μL of lysis buffer in each well of a 96-well semi-skirted plate. We use BrandTech #781375. Supplied in US by VWR #10141-434.
  • Add 20 μL of sample into each well.
  • We recommend one extra well with 200 μL lysis buffer only to use as a “no template control”.
  • Seal wells with 8-strip domed caps. We use BrandTech #781340. Supplied in US by VWR #80087-132.
  • To ensure proper mixing of the sample and buffer, vortex vigorously.
  • To pull the sample/buffer mixture to the bottom of the wells, quickly centrifuge at 1,000g for 10 sec before lysis.
  • Proceed to heat-activated lysis of the samples in a Thermocycler for 16 hours at 55oC, followed by heat inactivation for 10 minutes at 95oC.
o

This digested sample can be used directly as template DNA in qPCR for cf-DNA measurements.
  • Before performing qPCR, vortex and centrifuge again the template DNA-containing tube(s)/plate(s) at 1,000g for 10 sec at room temperature. If not using within 24 - 48h, freeze the DNA samples at -80ºC or colder.
6. qPCR data analysis and error checking
Compute the mean, standard deviation, and coefficient of variation (CV) for the cycle thresholds (Ct) across each triplicate for each sample.
If the CV across the 3 triplicates is >2%, check the triplicates to see if any of the wells has a Ct that is >1 unit different from the other two, which could indicate a qPCR failure in that well.
In the case where amplification has failed in a well, remove the outlier.
The average Ct for each sample should be used compute copies/mL.
Appendix A: qPCR Reagents and MasterMix Recipe
Recipe for each well of qPCR
TaqMan Universal MasterMix Fast 10 μL
ND1 Primers F+R + 0.6 μL
ND1 Probe + 0.4 μL
B2M Primers F+R + 0.6 μL
B2M Probe + 0.4 μL
Total Reagent Volume = 12 μL
+ Sample Volume + 8 μL
Total Reaction Volume = 20 μL
The reagents used may depend on the qPCR equipment available, the genomic locations of interest, or other experimental parameters. Below, we provide a summary of possible reagents as well as other validated primers and probes. 
2x TaqMan Universal MasterMix Fast                                            (Life Tech #4444965)
MicroAmp Optical 384-Well Reaction Plate with Barcode       (ThermoFisher #4309849)
MicroAmp Optical Adhesive Film                                               (ThermoFisher #4311971)
Validated mtDNA/nDNA Primer & Probe sequences                    (idtDNA.com)
qPCR Target Sequences (5′→3′)
Mouse mt- COX1-F ACCACCATCATTTCTCCTTCTC
Mouse mt-COX1- R CTCCTGCATGGGCTAGATTT
Mouse mt- COX1-Probe: HEX/AAGCAGGAG/ZEN/CAGGAACAGGATGAA/3IABkFQ
Mouse B2M-F GAGAATGGGAAGCCGAACATA
Mouse B2M- CCGTTCTTCAGCATTTGGATTT
Mouse B2M-Probe FAM/CGTAACACA/ZEN/GTTCCACCCGCCTC/3IABkFQ
- Reconstitute primers in appropriate volume of nuclease free water to achieve 100 μM stock concentration.
- Combine 120 μL each of 100 μM forward and reverse primers with 960 μL nuclease free water to achieve 10 μM working concentration.
- Store primers at -30ºC or -80ºC until use.
- Reconstitute probe in appropriate volume of nuclease free water to achieve 100 μM stock concentration.
- Dilute 100 μM stock probe 20x to achieve 5 μM working concentration.
- Store probes at -30oC or -80oC until use (avoid freeze-thaw) and protect probes from light.