Mar 11, 2026
Molecular testing for crop viruses (School Genetics Club)
- Maximilian Schughart1,
- Tracey Mason2,
- Stephen Byrne1,
- Louise McNamara1,
- Marta Niedzicka1
- 1Teagasc;
- 2ABE Ireland
Protocol Citation: Maximilian Schughart, Tracey Mason, Stephen Byrne, Louise McNamara, Marta Niedzicka 2026. Molecular testing for crop viruses (School Genetics Club). protocols.io https://dx.doi.org/10.17504/protocols.io.14egn9xnql5d/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: November 04, 2024
Last Modified: March 11, 2026
Protocol Integer ID: 111499
Keywords: yellow dwarf virus, genetics club, outreach, molecular testing for crop virus, molecular testing, pcr assay, multiplex pcr reaction, simplex pcr reaction, crop virus, aphid gene, testing, samples with primer, pcr inhibitor, samples with the primer, pcr, unknown samples for testing, virus genome, control gene, primer, school genetics club, assay, sample, batch of sample, student, insect, virus, new primer
Funders Acknowledgements:
Research Ireland
Grant ID: 22/FFP-A/11049
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK
The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
This describes a protocol that can be carried out in a classroom environment for educational purposes. It enables students to get hands-on practice of running a PCR to identify if an insect has a virus. Control material can be provided along with unknown samples for testing. A primer set targeting an aphid gene is also provided to help the students reduce false negatives (for example due to extraction failures, or PCR inhibitors being present in the sample). This can be carried out as a simplex PCR reaction (testing one primer at a time), and once evaluated, students can investigate how they might reduce workload and move to a multiplex PCR reaction (where the control gene and virus are amplified simultaneously).
The students will be provided with eight samples that need to be tested to determine if they are positive or negative for the sample. They will also be provided with positive and negative controls to run with each batch of samples. The students should first test the samples with primers targeting the virus and compile the results. They then should test the samples with the primers targeting an aphid gene to make sure all samples are OK and amplify a product as expected.
Troubleshooting
Preparation
Identify the templates you want to use as input for your PCR amplification - these will consist of:
- samples you want to test for yellow dwarf virus (these will be labelled US01, US02, ... etc)
- positive controls (representing virus infected aphids to help the researcher know that their protocol worked, these will be labelled PC-MAV),
- a negative control (representing virus free aphids to help the researcher ensure that PCR amplification will not show a product for the virus when an aphid is not infected, this will be labelled NC-SA), and
- a no template control (this has no template DNA available for amplification by PCR and helps the researcher ensure that their reagents are free from contamination, it is labelled as NTC).
Identify the primers you want to use in the test and thaw on ice. The following table shows the primer details that can be used to identify if an aphid has the virus BYDV-MAV. There is also primers that target a gene in the aphid (GAPDH gene) and this can be used as a control to make sure your extraction worked (so help to reduce false negatives). The choice of primers to use will depend on your target assay and each primer is provided as a working solution at 10 micromolar (µM) .
Primers:
| Primer Name | Primer Sequence | |
| GAPDH-SA-For | GGCGAAGTTTCTGTTGATGG | |
| GAPDH-SA-Rev | CAGCACCAGCAGATCCCC | |
| MAV-For | GTTACAAGATCACAAACGTCAAG | |
| MAV-Rev | TGTTGAGGRGTCTACCTATTTG |
Each PCR will require a forward and reverse primer:
- if testing for the virus then you can use MAV-For and MAV-Rev,
- if amplifying the aphid gene GAPDH then you can use GAPDH-SA-For and GAPDH-SA-Rev
Identify the remaining ingredients required to run the PCR and place on ice - (i) the enzyme master mix to carry out the amplification, and (ii) molecular biology grade water. The enzyme master mix is called Classic Taq++ (Tonobo) and this contains Taq polymerase (to amplify the DNA), dNTPs (nucleotide building blocks used during amplification), and buffers. This is supplied in a 2X concentration (so for example, to get 1X in a final reaction of 25 µL you would need to add 12.5 µL of Classic Taq++).
Identify the total number of reactions that will be carried out (this is the number of test sample plus the controls) and select appropriate plastics that will be used to prepare and hold reactions during the PCR.
PCR protocol
4m 45s
Each reaction needs to be prepared according to the following recipe:
| Component | quantity per reaction | |
| Classic Taq ++ | 12.5 µl | |
| Molecular grade H2O | 9.5 µl | |
| forward primer | 1 µl | |
| reverse primer | 1 µl | |
| Template* | 1 µl | |
| total | 25 µl |
*the template is the only component that changes across reactions, this will either be test sample, control, or water (in the case of NTC).
The reactions should be prepared in PCR strips, individual PCR tubes, or PCR plates (be sure to label or record plate position so you know what template/sample was in what tube or well).
Place the reactions in a thermo cycler and run the following PCR cycle:
- 95 °C 00:01:00
followed by 40 cycles of
- 95 °C 00:00:15
- 60 °C 00:00:15
- 72 °C 00:00:15
and a final elongation step of
- 72 °C 00:03:00
4m 45s
Once the PCR cycle is finished then place the reactions on ice until gel electrophoresis. Note: the completed reactions can be placed in the freezer until ready to move to gel electrophoresis.
Gel electrophoresis
Identify the ingredients you need to carry out visualisation of your PCR products, (i) running buffer, (ii) agarose gel, (iii) DNA ladder, (iv) GelGreen or equivalent, (v) blue light transilluminator.
Prepare a 1.2 percent TBE agarose gel according to standard protocol.
Use 5 µL of PCR product together with 5 µL of water and 2 µL of 6X loading buffer.
Load the samples into the gel alongside a 100 bp DNA ladder for time appropriate for voltage and gel size.
Prepare a 3X GelGreen staining solution and place the gel into solution (for example in an old lunch/take-away box) with gentle agitation for approximately 00:30:00 .
Image the gels with a blue light transilluminator.