May 10, 2020
Version 1
Modified protocol for URA3 counter-selection at highly expressed regions of Saccharomyces cerevisiae V.1
- 1protocols.io;
- 2University of California, Berkeley
- Yeast Protocols, Tools, and Tips
Protocol Citation: Lenny Teytelman, Jasper Rine 2020. Modified protocol for URA3 counter-selection at highly expressed regions of Saccharomyces cerevisiae. protocols.io https://dx.doi.org/10.17504/protocols.io.bf7njrme
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
This protocol was suggested by Gille Fischer. In the Rine lab, it worked for Lenny Teytelman and Erin Osborne.
Created: May 10, 2020
Last Modified: May 10, 2020
Protocol Integer ID: 36814
Abstract
This is a modified protocol for URA3 counter-selection in S. cerevisiae and similar yeasts. It is identical to the standard counter-selection with two transformations, with the exception of the replica-plating step.
This protocol is appropriate for genomic loci where URA3 is over-expressed and the Ura3 protein is likely to be present in the colonies and cells at higher toxic levels. Because this method required five times as many plates for the replica-plating, it is more wasteful and should only be used when necessary.
Guidelines
[The following is from Appendix A of my 2009 doctoral dissertation at UC Berkeley.]
INTRODUCTION
To compare the efficiency of the establishment of silencing of the Rap1 binding sitevariants at HMR-E , I needed to substitute the original Rap1 binding site at HMR-E with the genomic consensus for Rap1. Bilge ¨Ozaydın constructed the fragment with the desired changes, and I just needed to perform two transformations to replace the native HMR-E sequence. The first transformation would delete the HMR-E sequence, replacing it with a URA3 cassette, and the subsequent transformation would replace the URA3 with the new construct from Bilge.
This type of counter-selection is a standard procedure and is usually done in a span of two-three weeks in budding yeasts. The first transformation to delete HMR-E was immediately successful, with high efficiency. Exactly as expected, it required only a single week. I confirmed the presence of the URA3 cassette at the right position within HMR-E by sequencing. The next step was like a battle between the single-cell eukaryote and the graduate student. Based on suggestions from countless lab meetings and personal troubleshooting sessions with members of the Eisen and Rine labs, over the course of three years, I repeated the second transformation numerous times, with some modifications
at each step.
While I have efficiently performed numerous transformations in S. cerevisiae and in S. bayanus, at different positions within each of their genomes, the specific Rap1 binding site counter-selection at HMR-E took three years of trial and error. The final, successful transformation required a modification of the standard protocol that warrants a description in this appendix. This is especially note-worthy because several member of the Rine lab have had persistent difficulties with this type of counterselection in the silenced regions of S. cerevisiae.
RESULTS
1. Logical changes in attempted transformations led to consistent failure
The first and successful transformation replaced a 450 base-pair sequence with a longer 1,600 base-pair cassette. The next transformation was to perform the reverse, replacing a long region with a shorter one. The efficiency of transforming with a short DNA sequence is lower than with long sequence (Annie Tsong, personal communication),
so I scaled up the second transformation, performing it three times in parallel on five cultures, instead of just one. A separate attempt at increasing the efficiency was to transform with a much higher concentration of the target construct, amplified by PCR and concentrated after gel-extraction. Yet another approach was to perform a co-transformation, with a plasmid and the genomic-Rap1-HMR-E. The plasmid included the LEU2 marker, allowing for initial selection for plasmid presence, followed by selection for the loss of URA3. This ensured that the cells had taken up DNA, at least as a plasmid, then asking if homologous recombination had occurred.
In addition to the above efforts to increase efficiency of the transformation, I attempted to control for silencing-specific interference. Theoretically, if silencing were to interfere with the homologous recombination of a transformation, this impact would be strongest in the initial transformation to replace HMR-E with URA3. However,
this step worked well, despite the silencing, and with HMR-E deleted, the locus would be derepressed. Nevertheless, as some Sir proteins may be recruited through the neighboring HMR-I, I performed the second transformation in the presence of nicotinamide. This chemical inhibits the catalytic activity of Sir2, leading to loss of silencing [91], and I grew the pre-transformation cultures with nicotinamide in the media. Erin Osbourne had similar difficulties with URA3 deletion at HMR. She also tried to perform counter-selection transformation in derepressed cells, using a strain
without the SIR3 gene. Neither one of us got the desired transformants with these methods.
Another potential problem could be the URA3 cassette. I initially used a Candida albicans URA3 cassette, driven by the TEF promoter [68]. The TEF promoter consists of multiple Rap1 binding sites and is a very strong activator [123]. To avoid overexpression of URA3 or any other TEF-related impact on homologous recombination, I constructed new strains, replacing the HMR-E with a Kluyveromyces lactis URA3, driven by its endogenous promoter [69]. Alas, as with the C. albicans cassette, I failed to counter-select against the K. lactis URA3.
Because colony-PCR may some times fail to detect successful transformations, for each of the above trials, I single-colony streaked up to 40 colonies, and performed regular PCR on DNA genomic preparations.
2. Crazy but successful modification
The counter-selection against URA3 relies on the toxicity of the Ura3 protein in the presence of 5-fluoroorotic-acid (5-FOA) [124, 125]. Because of a generation lag, where the Ura+ phenotype persists for several generations in a ura genotype, the standard protocol uses replica-plating from a YPD to a 5-FOA plate after transformation.
This allows the Ura3 protein to be diluted out of cells through division. An increase in URA3 expression or increased activity of the Ura3 protein could lead to a more persistent toxicity under 5-FOA. I allowed extra cell divisions by replica-plating from YPD to YPD, multiple times, before transferring cells to the 5-FOA plates.
While this procedure did not solve the problem, a variation on this dilution theme, suggested by Gille Fischer, finally worked. The modified step is the replica-plating from YPD to 5-FOA: after transferring the colonies onto the velvet, five YPD plates are successively pressed to the velvet and discarded before the main transfer to the 5-FOA plate. The modified protocol is described in detail in the Materials and Methods section below. The resulting transformation efficiency is very high, with eight out of ten screened colonies having the correct integration.
DISCUSSION
The final success of the URA3 counter-selection at HMR-E of S. cerevisiae is a small personal triumph over a technical difficulty, but the procedural change is certain to be of use for other researchers. Erin Osborne, a lab mate in the Rine lab, had similar difficulties with a counter-selection against URA3 at HMR, and the modified protocol has also worked for her with a high efficiency.
The particular difficulty at HMR may be due to subtelomere-related overexpression of URA3 from the TEF promoter. There is preliminary evidence that TEF-driven expression increases dramatically at positions closer to the telomeres (Menzies Chen, personal communication). One hypothesis is that the Rap1 presence at telomeres creates a locally high pool of Rap1 in the vicinity of subtelomeric regions, resulting in overexpression from the TEF promoter, only at loci that are telomere-proximal.
In turn, this increase in expression may result in increased generational lag in the toxicity of Ura3 on 5-FOA. This may explain the difficulty of replacing the C. albicans URA3 with the TEF promoter, but I also failed to replace the K. lactis URA3 under the control of its endogenous promoter. However, I performed the K. lactis transformation only once, and these comparisons would need to be extended for a definitive test. It is also possible that the K. lactis promoter also has one or more Rap1 binding sites.
The most likely explanation for the success of the modified protocol is dilution of Ura3. After the transformation heat-shock, cells are spread on YPD plates for over-night growth. As a colony forms on the plate, staring from a single cell, it spreads out in three dimensions, in a cone-like shape. The most recently-divided cells will be at the top of the cone. However, for replica-plating to the 5-FOA plate, the YPD plate is pressed onto the velvet, inverting the cone. In contrast to the order on the YPD plate, the newest cells will be directly on the velvet, and the surface layer will include the oldest cells. The mock-replica-plating onto five YPD plates before the real transfer to the 5-FOA plate, may be sectioning through the colony layers in reverse-chronological order, enriching for the youngest cells for the 5-FOA plate. This sectioning may dilute the Ura3 protein concentration in the cells that end up on the 5-FOA plate, reducing the toxicity. A careful controlled test of this model has not been performed. The experiment suggested by this model is a transformation and replica-plating with successive 5-FOA plates instead of the mock-replicas with YPD plates. If the dilution hypothesis is correct, the number of successful transformed colonies should increase on successive 5-FOA plates.
MATERIALS AND METHODS
1. Transformation to replace HMR-E with URA3
The HMR-E sequence was replaced in S. cerevisiae JRY3009 with the K. lactis URA3 construct (EUROSCARF plasmid pUG72 [69]), using primers TTTCAATTTTTTATTAAACAATGTTTGATTTTTTAAATCGcagctgaagcttcgtacgc and AGATTAAGCTCATAACTTGGACGGGGATCGTTCGTATTTTgcataggccactagtggatctg to amplify the K. lactis URA3 cassette. Transformation was performed using the LiAc method [126]. The parental cells were heat-shocked in the transformation mix for 40 minutes at 42◦C, and then resuspended in 250 μl of YPD and plated directly onto a CSM-Ura plate. The resulting hmr-e△::KL URA3 strains (JRY8991, JRY8992) were two distinct colonies from the CSM-Ura3 plate. The correct integration was confirmed by sequencing. A similar replacement was performed with a Candida albicans URA3 cassette (EUROSCARF plasmid pAG60 [68]), resulting in the hmre △::CA URA3 strain (JRY8993). Primers with 40 base-pairs of HMR-E homology for amplification of the URA3 cassette were TTTCAATTTTTTATTAAACAATGTTTGATTTTTTAAATCGcggatccccgggttaattaa and AGATTAAGCTCATAACTTGGACGGGGATCGTTCGTATTTTcgatgaattcgagctcgttt.
2. Modified protocol to counter-select against URA3
The transformation to replace the URA3 cassette with the genomic-Rap1-HMR-E sequence was performed largely as above. The two strains with hmr-e△::KL URA3 (JRY8991, JRY8992) were grown in CSM-Ura cultures. After the heat-shock, the cells were plated onto YPD-plates, for overnight growth. In the subsequent replica-plating, the YPD plate is pressed onto the velvet on the replica-plating block. Then, five distinct YPD plates are pressed against the velvet, with each plate discarded. After the five mock-YPD replicas, a single 5-FOA plate is pressed against the same velvet. To screen for the correct integration, I picked ten colonies on each of the two 5-FOA plates, single-colony streaked each one, and then isolated genomic DNA with a Qiagen genomic prep. PCR fragments from the colonies with the expected PCR products were sequenced with primers TCCTTCACATCATGAAATATAA and ACCAGGAGTACCTGCGCTTATTCT, confirming the correct integration of the genomic-Rap1- HMR-E sequence. The resulting strains (JRY8994, JRY8995) were used in the experiments described in Chapter 3 of the thesis.
REFERENCES
[68] Goldstein AL, McCusker JH (1999) Three new dominant drug resistance cassettes
for gene disruption in saccharomyces cerevisiae. Yeast (Chichester, England)
15:1541–1553.
[69] Gueldener U, Heinisch J, Koehler GJ, Voss D, Hegemann JH (2002) A second
set of loxp marker cassettes for cre-mediated multiple gene knockouts in budding
yeast. Nucleic Acids Research 30:e23.
[91] Bitterman KJ, Anderson RM, Cohen HY, Latorre-Esteves M, Sinclair DA
(2002) Inhibition of silencing and accelerated aging by nicotinamide, a putative
negative regulator of yeast sir2 and human sirt1. the Journal of Biological
Chemistry 277:45099–45107.
[123] Morse RH (2000) Rap, rap, open up! new wrinkles for rap1 in yeast. Trends in
Genetics : TIG 16:51–53.
[124] Boeke JD, LaCroute F, Fink GR (1984) A positive selection for mutants lacking
orotidine-5’-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid
resistance. Molecular & General Genetics : MGG 197:345–346.
[125] Alani E, Cao L, Kleckner N (1987) A method for gene disruption that allows
repeated use of ura3 selection in the construction of multiply disrupted yeast
strains. Genetics 116:541–545.
[126] Gietz RD, Woods RA (2006) Yeast transformation by the liac/ss carrier
dna/peg method. Methods in Molecular Biology (Clifton, NJ) 313:107–120.
Transformation and selection
Transformation and selection
Perform the standard LiAc transformation to replace the locus of interest with the URA3 cassette.
Grow on CSM-Ura3 plates and confirm that the integration is correct by sequencing.
Counter-selection against URA3
Counter-selection against URA3
Perform the standard LiAc transformation to replace the URA3 cassette with the target sequence.
After the heat-shock, plate the cells onto YPD-plates, for Overnight growth.
Press the YPD plate onto the velvet on the replica-plating block.
[Mock replica-plating] Press a new YPD plate against the velvet and discard the plate.
[Mock replica-plating] Repeat Step6 another 4 times to slice through the layers with excess Ura3.
[Replica-plating] After the five mock-YPD replicas, press a single 5-FOA plate against the same velvet.
Grow the colonies and screen for the correct integration using sequencing.