Nov 21, 2022

Modified EMP ITS Illumina Amplicon Protocol 

Modified EMP ITS Illumina Amplicon Protocol
  • Dylan P. Smith1,
  • Kabir G. Peay1,
  • Gail Ackermann1,
  • Amy Apprill1,
  • Markus Bauer1,
  • Donna Berg-Lyons1,
  • Jason Betley1,
  • T. D. Bruns1,
  • J. Greg Caporaso1,
  • Noah Fierer1,
  • Louise Fraser1,
  • Jed A. Fuhrman1,
  • M. Gardes1,
  • Jack A. Gilbert1,
  • Niall Gormley1,
  • Greg Humphrey1,
  • James Huntley1,
  • Janet K. Jansson1,
  • Rob Knight1,
  • Chris L. Lauber1,
  • S. Lee1,
  • Sarah M. Owens1,
  • Alma E. Parada1,
  • Geoff Smith1,
  • J. Taylor1,
  • Luke Thompson1,
  • Willam A. Walters1,
  • T. J. White1
  • 1EMP Consortium
  • stajichlab
Icon indicating open access to content
QR code linking to this content
Protocol CitationDylan P. Smith, Kabir G. Peay, Gail Ackermann, Amy Apprill, Markus Bauer, Donna Berg-Lyons, Jason Betley, T. D. Bruns, J. Greg Caporaso, Noah Fierer, Louise Fraser, Jed A. Fuhrman, M. Gardes, Jack A. Gilbert, Niall Gormley, Greg Humphrey, James Huntley, Janet K. Jansson, Rob Knight, Chris L. Lauber, S. Lee, Sarah M. Owens, Alma E. Parada, Geoff Smith, J. Taylor, Luke Thompson, Willam A. Walters, T. J. White 2022. Modified EMP ITS Illumina Amplicon Protocol . protocols.io https://dx.doi.org/10.17504/protocols.io.6qpvrdmeogmk/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: March 02, 2021
Last Modified: November 21, 2022
Protocol Integer ID: 47834
Keywords: fungal microbial eukaryotic lineage, illumina amplicon protocol, illumina platform with primer, illumina amplicon, illumina platform, illumina, biocrust project at university, biocrust project, modified emp
Abstract
The ITS protocol detailed here is designed to amplify fungal microbial eukaryotic lineages using paired-end community sequencing on the Illumina platform with primers ITS1f-ITS2 (EMP.ITSkabir).

Note: This a modified version used in biocrust project at University of California Riverside.
Guidelines

Ordering primers

The primer sequences in this protocol are always listed in the 5′ -> 3′ orientation. This is the orientation that should be used for ordering. See the page Primer Ordering and Resuspension for more information. Primer constructs were designed by Dylan Smith and Kabir Peay.
Note: Unlike the 16S and 18S sequencing primers, the ITS sequencing primers have additional 3′ bases beyond the PCR primers, in order to match the melting temperature of the Illumina adapters. The forward sequencing primer has 19 and the reverse sequencing primer has 15 additional 3′ bases; therefore the amplicon sequences will begin 19 bp (forward read) and 15 bp (reverse read) after the PCR primers. 

EMP.ITSkabir forward primer (ITS1f)

Field descriptions (space-delimited):
  1. 5′ Illumina adapter
  2. Forward primer linker
  3. Forward primer (ITS1f; Note: This is 38 bp upstream of ITS1 from White et al., 1990.)

AATGATACGGCGACCACCGAGATCTACAC GG CTTGGTCATTTAGAGGAAGTAA










EMP.ITSkabir reverse primer (ITS2), barcoded

Field descriptions (space-delimited):
  1. Reverse complement of 3′ Illumina adapter
  2. Golay barcode
  3. Reverse primer linker
  4. Reverse primer (ITS2; Note: This is identical to ITS2 from White et al., 1990.)

CAAGCAGAAGACGGCATACGAGAT NNNNNNNNNN CG GCTGCGTTCTTCATCGATGC




























PCR reaction mixtures





Notes:
  • PCR-grade water from Sigma (cat. no. W3500) or MoBio (cat. no. 17000-11)
  • Platinum Hot Start PCR Master Mix (2x) from ThermoFisher (cat. no. 13000014)
  • Final master mix concentration in 1x reaction: 0.8x
  • Final primer concentration in 1x reaction: 0.2 µM
Thermocycler conditions 
ITS amplification 
  • Primers: ITS1f-ITS2
  • Amplicon size: ~230 bp


References

Caporaso, J. G., Lauber, C. L., Walters, W. A., Berg-Lyons, D., Huntley, J., Fierer, N., Owens, S. M., Betley, J., Fraser, L., Bauer, M., Gormley, N., Gilbert, J. A., Smith, G., & Knight, R. (2012). Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. ISME J 6, 1621–1624. http://doi.org/10.1038/ismej.2012.8 Gardes, M., & Bruns, T. D. (1993). ITS primers with enhanced specificity for basidiomycetes ‐ application to the identification of mycorrhizae and rusts. Molecular Ecology, 2(2), 113–118. http://doi.org/10.1111/j.1365-294X.1993.tb00005.x Smith, D. P., & Peay, K. G. (2014). Sequence depth, not PCR replication, improves ecological inference from next generation DNA sequencing. PLoS ONE, 9(2), e90234–e90234. http://doi.org/10.1371/journal.pone.0090234 Walters, W., Hyde, E. R., Berg-Lyons, D., Ackermann, G., Humphrey, G., Parada, A., Gilbert, J. A., Jansson, J. K., Caporaso, J. G., Fuhrman, J. A., Apprill, A., & Knight, R. (2016). Improved bacterial 16S rRNA gene (V4 and V4-5) and fungal internal transcribed spacer marker gene primers for microbial community surveys. mSystems, 1(1), e00009–15. http://doi.org/10.1128/mSystems.00009-15 White, T. J., Bruns, T., Lee, S., & Taylor, J. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR protocols: a guide to methods and applications (pp. 315–322). New York: Academic Press.
Materials
MATERIALS
PCR-Grade WaterMerck MilliporeSigma (Sigma-Aldrich)Catalog #W3500
Platinum Hot Start PCR Master Mix (2x)Thermo Fisher ScientificCatalog #13000014
Quant-iT™ PicoGreen™ dsDNA Assay KitInvitrogen - Thermo FisherCatalog #P11496
UltraClean PCR Clean Up KitMobioCatalog #12500-250-1
STEP MATERIALS
Quant-it™ PicoGreen® dsDNA Assay KitLife TechnologiesCatalog #P7589
UltraClean PCR Clean Up KitMobioCatalog #12500-250-1
Quant-it™ PicoGreen® dsDNA Assay KitLife TechnologiesCatalog #P7589
UltraClean PCR Clean Up KitMobioCatalog #12500-250-1
Safety warnings
Please refer to the SDS (Safety Data Sheet) for safety and hazard information.
Before start
For running these libraries on the MiSeq and HiSeq, please make sure you read the supplementary methods of Caporaso et al. (2012). You will need to make your sample more complex by adding 5-10% PhiX to your run.
Amplification Protocol
Amplify samples in triplicate. 
Note
Each sample will be amplified in 3 replicate 25-µL PCR reactions.
Pool triplicate PCR reactions for each sample into a single volume (75 µL). Do not combine amplicons from different samples at this point.
Run amplicons from each sample on an agarose gel. 
Note
Low-biomass samples may yield faint or no visible bands; alternative methods such as a Bioanalyzer could be used to verify presence of PCR product.
Expected result
Expected band size for ITS1f-ITS2 is ~230 bp.
Quantify amplicons (DNA concentration) with NanoDrop spectrophotometer.


Clean up the amplicons using magnetic bead clean up. Please contact Matthew Collin [email protected] for the bead clean up protocol.
Combine an equal amount of amplicon from each sample (240 ng) into a single, sterile tube. Higher amounts can be used if the final pool will be gel-isolated or when working with low-biomass samples.
Note
When working with multiple plates of samples, it is typical to produce a single tube of amplicons for each plate of samples.
Measure concentration and A260/A280 ratio of final pool that has been cleaned. 


Expected result
For best results the A260/A280 ratio should be between 1.8-2.0.
Send an aliquot for sequencing along with sequencing primers listed below.

ITS sequencing primers

Read 1 sequencing primer

Field descriptions (space-delimited):
  1. Forward primer segment
  2. Extended region into amplicon

TTGGTCATTTAGAGGAAGTAA AAGTCGTAACAAGGTTTCC




Read 2 sequencing primer

Field descriptions (space-delimited):
  1. Reverse primer segment
  2. Extended region into amplicon

CGTTCTTCATCGATGC VAGARCCAAGAGATC




Index sequencing primer

  1. Reverse complement of extended amplicon region
  2. Reverse complement of reverse primer
  3. Reverse complement of linker

TCTC GCATCGATGAAGAACGCAGC CG