Aug 28, 2025
Microglia differentiation from human pluripotent stem cells (v2;optimised)
- Nina-Lydia Kazakou1,2,
- Josefine Rågård Christiansen1,2,
- Agnete Kirkeby1,2
- 1Aligning Science Across Parkinson’s (ASAP) Collaborative Research Network, Chevy Chase, MD, 20815, USA;
- 2Novo Nordisk Foundation Center for Stem Cell Medicine, reNEW
Protocol Citation: Nina-Lydia Kazakou, Josefine Rågård Christiansen, Agnete Kirkeby 2025. Microglia differentiation from human pluripotent stem cells (v2;optimised). protocols.io https://dx.doi.org/10.17504/protocols.io.e6nvw41n2lmk/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: August 27, 2025
Last Modified: August 28, 2025
Protocol Integer ID: 225638
Keywords: ASAPCRN, microglia differentiation from human pluripotent stem cell, microglia differentiation, microglia, human pluripotent stem cell, differentiation of hpsc, myeloid progenitor
Funders Acknowledgements:
ASAP-000520
Grant ID: ASAP-000520
ASAP-024296
Grant ID: ASAP-024296
ASAP-025170
Grant ID: ASAP-025170
Abstract
Protocol for the directed differentiation of hPSCs towards erythro-myeloid progenitors and further to microglia.
Based on Washer et al, Sci Rep, 2022 with input from Bioneer A/S. Option to use "De Strooper" protocol variant (Fattorelli et al, Nature Protocols, 2021) is described.
Materials
| Reagent | Vendor | Cat. no | |
| mTeSR1 Basal Medium and 5x supplement kit | STEMCELL Technologies | 85850 | |
| X-VIVO 15 | Lonza | BE04-418 | |
| Advanced DMEM/F12 | Gibco | 12634010 | |
| GlutaMAX | Life Technologies | 35050-061 | |
| β-mercaptoethanol | Life Technologies | 31350-010 | |
| EDTA | Thermo Fisher | 15575020 | |
| DPBS | Thermo Fisher | A1285601 | |
| Y-27632 dihydrochloride | Miltenyi | 130-106-538 | |
| KnockOut‱ Serum Replacement | Thermo Fisher | 10828028 | |
| Pen/Strep | Life Technologies | 17502-048 | |
| BMP4 | Miltneyi | 130-111-165 | |
| VEGF | Miltneyi | 130-109-385 | |
| SCF | Miltneyi | 130-096-692 | |
| M-CSF | Miltneyi | 130-096-492 | |
| IL-3 | Miltneyi | 130-095-069 | |
| GM-CSF | Miltneyi | 130-093-864 | |
| IL-34 | Miltneyi | 130-108-977 | |
| TGFb1 | Peprotech | 100-21C-100UG | |
| TPO | Thermo Fisher (Peprotech) | 300-18 | |
| FLT3L | Thermo Fisher (Peprotech) | 300-19 | |
| Aggrewell 800 (24 wells) | STEMCELL Technologies | 34811 | |
| Reversible Strainer | StemCell | 27250 | |
| Anti-Adherence Rinsing Solution | STEMCELL Technologies | 7010 | |
| Matrigel | Corning | 354230 |
Troubleshooting
Media Compositions
EB formation (Aggrewell) medium (Day 0-6)
| Reagent | Stock Concentration | Final Concentration | Final Volume = 50ml | Dilution | |
| mTeSR1 | 49.7ml | ||||
| VEGF | 50 µg/ml | 50 ng/ml | 50µl | 1:1000 | |
| SCF | 20 µg/ml | 20 ng/ml | 50µl | 1:1000 | |
| BMP4 | 10 µg/ml | 50 ng/ml | 250µl | 1:200 | |
| Pen/Strep | 5,000 U/mL | 100 U/mL | 100µl | 1:500 | |
preMACS differentiation (Factories) medium - "De Strooper" protocol, Fattorelli et al, 2021 (Day 6-12)
| Reagent | Stock Concentration | Final Concentration | Final Volume = 100ml | Dilution | |
| X-VIVO15 | 98.2ml | ||||
| M-CSF | 100 µg/ml | 50 ng/ml | 50μl | 1:2000 | |
| IL-3 | 25 µg/ml | 50 ng/ml | 200μl | 1:500 | |
| SCF | 20 µg/ml | 50 ng/ml | 250μl | 1:400 | |
| TPO | 5 µg/ml | 5 ng/ml | 100μl | 1:1000 | |
| FLT3L | 50 µg/ml | 50 ng/ml | 100μl | 1:1000 | |
| GlutaMAX | 200 mM | 2 mM | 1ml | 1:100 | |
| β-mercaptoethanol | 50 mM | 50 μM | 100μl | 1:1000 | |
| Pen/Strep | 5,000 U/mL | 100 U/ml | 200μl | 1:500 |
preMACS differentiation (Factories) medium - "De Strooper" protocol, Fattorelli et al, 2021 (Day 13-)
| Reagent | Stock Concentration | Final Concentration | Final Volume = 100ml | Dilution | |
| X-VIVO15 | 98.2ml | ||||
| M-CSF | 100 µg/ml | 50 ng/ml | 50μl | 1:2000 | |
| GM-CSF | 10 µg/ml | 25 ng/ml | 250μl | 1:400 | |
| FLT3L | 50 µg/ml | 50 ng/ml | 100μl | 1:1000 | |
| GlutaMAX | 200 mM | 2 mM | 1ml | 1:100 | |
| β-mercaptoethanol | 50 mM | 50 μM | 100μl | 1:1000 | |
| Pen/Strep | 5,000 U/mL | 100 U/ml | 200μl | 1:500 |
preMACS differentiation (Factories) medium- "Cowley" protocol, Washer et al, 2022 (Day 6-)
| Reagent | Stock Concentration | Final Concentration | Final Volume | Dilution | |
| X-VIVO15 | 98.2ml | ||||
| M-CSF | 100 µg/ml | 100 ng/ml | 100µl | 1:1000 | |
| IL-3 | 25 µg/ml | 25 ng/ml | 100µl | 1:1000 | |
| GlutaMAX | 200 mM | 2 mM | 1ml | 1:100 | |
| β-mercaptoethanol | 50 mM | 50 µM | 100µl | 1:1000 | |
| Pen/Strep | 5,000 U/mL | 100 U/mL | 200µl | 1:500 |
Microglia Maturation Medium
| Reagent | Srock Concentration | Final Concentration | Final Volume | Dilution | |
| ADMEM/F12 | 98ml | ||||
| Glutamax | 200mM | 2mM | 1ml | 1:100 | |
| M-CSF | 100ug/ml | 25ng/ml | 25ul | 1:4000 | |
| GM-CSF | 10ug/ul | 10ng/ml | 100ul | 1:1000 | |
| IL-34 | 100ug/ul | 100ng/ml | 100ul | 1:1000 | |
| TGFb1 | 50ug/ml | 50ng/ml | 100ul | 1:1000 | |
| Pen/Strep | 5,000 U/mL | 100 U/mL | 200ul | 1:500 |
Embryo Body (EB) Generation
Preparation of Aggrewell-800 plates
Pre-treat wells with Anti-Adherence Rinsing Solution. For 24-well plates, add 500 μL per well
NOTE: Do not expose AggreWell plates to organic solvents, including ethanol or isopropanol
Centrifuge plate at 1300 x g for 3 minutes in a swinging bucket rotor fitted with plate holders
NOTE: Plates must be well-balanced. Prepare a balanced plate using a standard plate filled with water to match the weight and position of the Aggrewell plate
Observe the plate under a microscope to ensure bubbles have been removed from microwells. If bubbles remain trapped in any microwells, centrifuge at 1300 x g for an additional 3 minutes
Aspirate Anti-Adherence Rinsing Solution from the wells
Rinse each well with 500 μL of DMEM/F12 medium
Centrifuge at 1300 x g for an additional 3 minutes
Remove media and add 1ml of fresh DMEM/F12 medium (second wash)
hPSC dissociation: DIV 0
Cultures should be 70–80% confluent:
- homogeneous-appearing colonies with clear borders
- absence of obvious differentiating zones
Prepare appropriate volume of EB medium + 10μM Y-27632 ROCK inhibitor
Aspirate medium from hPSC cultures
Wash cells with appropriate PBS volume
Add the appropriate volume of 50uM EDTA in PBS
| Plate | Seeding area (Sarstedt) | EDTA 50uM (75μL/cm2) | |
| 6-well | 9.07 cm2 | 1.9ml | |
| 12-well | 3.65 cm2 | 700ul | |
| 24-well | 1.82 cm2 | 300ul |
Incubate at 37°C for 7 min
NOTE: If very confluent leave cells in the incubator for up to 10min
Add 1 mL of wash medium to the well and pipette off the colonies from all sides of the well using a P1000 pipette
- The cells should easily be removed by washing the well with a medium
- Prepare a single-cell suspension
Transfer the colonies to the 15 mL tube containing 10ml Wash Buffer
Count cells with Nucleocounter:
- Determine the concentration of cells/ml
- Determine the total volume of cell suspension to initiate differentiation
Transfer the appropriate cell suspension volume to a new tube
Centrifuge cells at 400g for 5min at RT
EB generation: DIV 0
To achieve EB size of 15,000 cells per EB, plate 4 x 10^6 cells in each well
Aspirate medium and resuspend cells in 1ml of EB medium per well
Add 1ml of cell suspension to each 24-well already containing 1ml of EB medium
Prepare a centrifuge balance plate using a standard plate filled with water to match the weight and position of the AggreWell plate
Pipette cells up and down gently several times to ensure even distribution of cells throughout the well
NOTE: Be careful not to introduce bubbles into the microwells
Centrifuge the AggreWell plate at 100 x g for 3 minutes to capture cells in the microwells
Incubate the plate at 37°C with 5% CO2 and 95% humidity
EB medium change: DIV 1 - DIV 6
Perform 75% medium change (EB medium) every day
Slowly remove 1.5ml of medium from each well
Replace with 1.5m of the fresh EB medium by slowly pipetting down the wall of the well; Slowly dispensing the medium prevents displacement of EBs/spheroids from the microwells
preMACS - "Cowley" version
Coat Flasks with Matrigel
Remove a pre-diluted aliquot of matrigel (5ml of 5% matrigel) from the freezer and thaw in the fridge overnight
Add 5ml of DMEM/F12 (w/ Glutamax) to each aliquot
- Matrigel should always be handled on ice
Add 10ml of the matrigel in the flask
Incubate the flask at 37°C with 5% CO2 and 95% humidity for at least 1h
Remove coatingbefore seeding the EBs
Transfer EBs into matrigel coated T75 flask
Remove EBs carefully from Aggrewells using a 5ml stripette
Transfer EBs to a 40μm invertible cell strainer; Use a 50ml Falcon tube as liquid waste beneath the strainer
- This step ensures that only EBs are transferred into the flask
- Single & dead cells are captured on the strainer membrane
Flash the remaining EBs from the Aggrewell using 2ml PBS and transferto the strainer
Repeat step 3
Wash dead cells away from the EB in the strainerusing 4 mL of PBS
Invert the strainer over a new 50ml Falcontube and wash off EBs off using 4 mL of
preMACS differentiation medium
Divide EBs evenly into two matrigel-coated T75 flasks, each containing 18ml of
preMACS differentiation medium (total V = 20ml)
Incubate the plate at 37°C with 5% CO2 and 95% humidity
preMACS Factoriesmedia change: ~ till DIV35
Factories are fed weekly by adding
10ml of preMACS differentiation media until macrophage/microglia precursors (preMACS) cells start to appear in the supernatant; This process usually takes ~5 weeks
NOTE: At this point,preMACS can be used for microglia maturation experiments
Factories can be maintained successfully for at least 4mo:
- Factories are fed weekly by adding 10ml of preMACS differentiation media
- This is okay for most cell lines, including RC17, but it needs to be adjusted to twice a week for other lines, like KOLF2.1; Keep an eye on the media color and adjust as necessary
- When the flask becomes too full, transfer the supernatant containing the preMACS in the suspension into a 50ml Falcon tube, centrifuge for 5min at 400g, remove supernatant, resuspend preMACS into 10ml of preMACS differentiation media, and return the freshly resuspended preMACS into the relevant flask
preMACS - "De Strooper" version
Follow the steps described for the "Cowley" protocol - the only difference is the preMACmedia composition (see table above)
QC preMACS by FACS
From around DIV30 onwards,preMACs can be analysed by flow cytometry for the co-expression of CD45 and CD11b using the protocol and antibodies linked below. The time of QC depends on the cell line; for example, RC17s are typically not ready before DIV40.
| Antibody | Cat. no | Company | Flurophore | Dilution | |
| CD45 | 555482 | BD Biosciences | FITC | 1:100 | |
| CD11b | 301352 | Biolegend | APC/Fire750 | 1:500 |
Microglia monolayer differentiation
- From ~DIV35 onwards,free-floating preMACS in the Factories supernatant can be collected and matured into microglia with/ Microglia Maturation Medium (MMM).
- preMACS can be seeded on plastic plates or glass coverslips.
- Microglia can be used between preMACS seeding day +7d of MMM until preMACS seeding day +2mo of MMM.
- preMACs for maturation into microglia are seeded at 100,000 cells/cm2
Seeding monolayermicroglia
Aspirate all medium from a preMACsFactory containing flask
Transfer into a 50ml Falcon througha 40um strainer
Count cells using a nuclecounter to determine the concentration of cells/ml
Determine the total volume of cell suspension needed and transferthe appropriate volume into a new
Falcon tube
NOTE: Do not leave the preMACsin the tube for too long, as cells tend to stick to
everything, including the tube walls
Centrifuge cells at 400g for 5min at RT
Aspirate medium and resuspend cells in MMM (according to the table below)
| Plate | Seeding area | MMM (V) | |
| 6-well | 9.07 cm2 | 2.5ml | |
| 12-well | 3.65 cm2 | 1ml | |
| 24-well | 0.64 cm2 | 500ul | |
| 48-well | 1.82 cm2 | 300ul | |
| 96-well | 0.29 cm2 | 100ul |
Incubate the plate at 37°C with 5% CO2 and 95% humidity
Monolayer microglia media change
Perform 50% medium change(MMM) every other day
Microglia monolayers can be maintained successfully for up to 2mo
QC microglia by qRT-PCR
| Gene name | Primer_Fw | Primer_Rv | |
| P2RY12 | TGCCAAACTGGGAACAGGACCA | TGGTGGTCTTCTGGTAGCGATC | |
| TMEM119 | AGTCCTGTACGCCAAGGAAC | GCAGCAACAGAAGGATGAGG | |
| TREM2 | ATGATGCGGGTCTCTACCAGTG | GCATCCTCGAAGCTCTCAGACT | |
| CSF1R | TCCAAAACACGGGGACCTATC | CGGGCAGGGTCTTTGACATA | |
| CX3CR1 | CACAAAGGAGCAGGCATGGAAG | CAGGTTCTCTGTAGACACAAGGC | |
| IRF8 | TGGCTGATCGAGCAGATTGACAGT | AAGGGATCCGGAACATGCTCTTCT | |
| PU.1 | GAGCCCCCCACTGGAGGT | TGGTACAGGCGGATCTTCTTCT | |
| CD68 | CGAGCATCATTCTTTCACCAGCT | ATGAGAGGCAGCAAGATGGACC | |
| AIF1/IBA1 | CCCTCCAAACTGGAAGGCTTCA | CTTTAGCTCTAGGTGAGTCTTGG | |
| ITGAM/CD11b | GGAACGCCATTGTCTGCTTTCG | ATGCTGAGGTCATCCTGGCAGA | |
| CD44 | GGACACCATGGACAAGTTTTGG | CACGTGGAATACACCTGCAAAG | |
| MERTK | CAGGAAGATGGGACCTCTCTGA | GGCTGAAGTCTTTCATGCACGC | |
| CD45 | CTTCAGTGGTCCCATTGTGGTG | CCACTTTGTTCTCGGCTTCCAG | |
| CCR2 | TGG CTG TGT TTG CTT CTG TC | TCT CAC TGC CCT ATG CCT CT | |
| GAPDH | TTGAGGTCAATGAAGGGGTC | GAAGGTGAAGGTCGGAGTCA | |
| ACTB_v2 | ATGTGGCCGAGGACTTTGATTG | ATGGCAAGGGACTTCCTGTAAC |
QC microglia by ICC
After 7 days in MMM, monolayer microglia should be positive for the following markers:
| Antibody | Cat. no | Company | Concentration | |
| CD45 | 304002 | BioLegend | 1:300 | |
| PU.1 | 2258S | Cell Signaling | 1:300 | |
| IBA1 | 434200 | Thermo Fisher | 1:500 |
Protocol references