Jul 29, 2025

Methods from: Multiplex, single-cell CRISPRa screening for cell type specific regulatory elements V.2

  • Florence Chardon1,
  • Troy McDiarmid1
  • 1Department of Genome Sciences, University of Washington
Icon indicating open access to content
QR code linking to this content
Protocol CitationFlorence Chardon, Troy McDiarmid 2025. Methods from: Multiplex, single-cell CRISPRa screening for cell type specific regulatory elements. protocols.io https://dx.doi.org/10.17504/protocols.io.j8nlkor2wv5r/v2Version created by Beth Martin
Manuscript citation:
Multiplex, single-cell CRISPRa screening for cell type specific regulatory elements
Florence M. Chardon, Troy A. McDiarmid, Nicholas F. Page, Beth Martin, Silvia Domcke, Samuel G. Regalado, Jean-Benoît Lalanne, Diego Calderon, Lea M. Starita, Stephan J. Sanders, Nadav Ahituv, Jay Shendure
BioRxiv
doi: https://doi.org/10.1101/2023.03.28.534017
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: November 25, 2024
Last Modified: July 29, 2025
Protocol  Integer ID: 112747
Keywords: specific regulatory elements crispr, crispra perturbations of both enhancer, cell crispra screening for cell type, cell crispra screening, upregulating target gene, successful gene activation, cell rna, based gene activation, upregulating gene expression, gene activation, gene therapy, risk gene, promising therapeutic approach for gene therapy, gene expression, rna, relevant gene, autism spectrum disorder, targeting promoter, including autism spectrum disorder, neurodevelopmental disorder, regulatory elements in both k562 cell, random combinations of many grna, derived excitatory neuron, responsiveness of individual enhancer, crispra
Funders Acknowledgements:
Weill Neurohub
NHGRI
Grant ID: UM1HG011966
NIMH
Grant ID: U01MH12268
NIMH
Grant ID: R01MH116999
Abstract
CRISPR-based gene activation (CRISPRa) is a promising therapeutic approach for gene therapy, upregulating gene expression by targeting promoters or enhancers in a tissue/cell-type specific manner. Here, we describe an experimental framework that combines highly multiplexed perturbations with single-cell RNA sequencing (sc-RNA-seq) to identify cell-type-specific, CRISPRa-responsive cis-regulatory elements and the gene(s) they regulate. Random combinations of many gRNAs are introduced to each of many cells, which are then profiled and partitioned into test and control groups to test for effect(s) of CRISPRa perturbations of both enhancers and promoters on the expression of neighboring genes. Applying this method to candidate cis-regulatory elements in both K562 cells and iPSC-derived excitatory neurons, we identify gRNAs capable of specifically and potently upregulating target genes, including autism spectrum disorder (ASD) and neurodevelopmental disorder (NDD) risk genes. A consistent pattern is that the responsiveness of individual enhancers to CRISPRa is restricted by cell type, implying a dependency on either chromatin landscape and/or additional trans-acting factors for successful gene activation. The approach outlined here may facilitate large-scale screens for gRNAs that activate therapeutically relevant genes in a cell type-specific manner.
Cell Lines and Culture
K562 cell culture
K562s cells are a pseudotriploid ENCODE Tier I erythroleukemia cell line derived from a female (age 53) with chronic myelogenous leukemia15. All K562 cells were grown at 37°C, and cultured in RPMI 1640 + L-Glutamine (GIBCO, Cat. No. 11-875-093) supplemented with 10% fetal bovine serum (Rocky Mountain Biologicals, Cat No. FBS-BSC) and 1% penicillin-streptomycin (GIBCO/ Thermo Fisher Scientific; Cat. No. 15140122).
Induced pluripotent stem cell (iPSC) culture
Human WTC11 iPSCs equipped with a doxycycline-inducible NGN2 transgene expressed from the AAVS1 safe-harbor locus as well as an ecDHFR-dCas9-VPH construct (VPH consists of 12 copies of VP16, fused with a P65-HSF1 activator domain) expressed from the CLYBL safe-harbor locus were a gift from the Kampmann lab6. These iPSCs were cultured in mTeSR Plus Basal Medium (Stemcell technologies; Cat. No. 100-0276) on Greiner Cellstar plates (Sigma-Aldrich; assorted Cat. Nos.) coated with Geltrex LDEV-Free, hESC-Qualified, Reduced Growth Factor Basement Membrane Matrix (Gibco; Cat. No. A1413302) diluted 1:100 in Knockout DMEM (GIBCO/Thermo Fisher Scientific; Cat. No. 10829018). mTeSR Plus Basal Medium was replaced every other day. When 70–80% confluent, cells were passaged by aspirating media, washing with DPBS (GIBCO/Thermo Fisher Scientific; Cat. No. 14190144), incubating with StemPro Accutase Cell Dissociation Reagent (GIBCO/Thermo Fisher Scientific; Cat. No. A1110501) at 37 °C for 5 min, diluting Accutase 1:1 in mTeSR Plus Basal Medium, collecting cells in conical tubes, centrifuging at 800g for 3 min, aspirating supernatant, resuspending cell pellet in mTeSR Plus Basal Medium supplemented with 0.1% dihydrochloride ROCK Inhibitor (Stemcell technologies; Cat. No. Y-27632), counting and plating onto Geltrex-coated plates at the desired number.
Human iPSC-derived neuronal cell culture, differentiation, and CRISPRa induction
The iPSCs described above were used for the differentiation protocol below. On day -3, iPSCs were dissociated and centrifuged as above, and pelleted cells were resuspended in Pre-Differentiation Medium containing the following: Knockout DMEM/F-12 (GIBCO/Thermo Fisher Scientific; Cat. No. 12660012) as the base, 1X MEM Non-Essential Amino Acids (GIBCO/Thermo Fisher Scientific; Cat. No. 11140050), 1X N-2 Supplement (GIBCO/ Thermo Fisher Scientific; Cat. No. 17502048), 10 ng/mL NT-3 (PeproTech; Cat. No. 450-03), 10ng/mL BDNF (PeproTech; Cat. No. 450-02), 1 ug/mL Laminin mouse protein (Thermo Fisher Scientific; Cat. No. 23017015), 10 nM ROCK inhibitor, and 2 mg/mL doxycycline hyclate (Sigma-Aldrich; Cat. No. D9891) to induce expression of NGN2. iPSCs were counted and plated at 800K cells per Geltrex-coated well of a 12-well plate in 1 mL of Pre-Differentiation Medium, for three days. At day -2 and day -1, media changes were performed using pre-differentiation medium without ROCK inhibitor. On day -1, 12-well plates for differentiation were coated with 15 ug/mL Poly-L-Ornithine (Sigma-Aldrich; Cat. No. P3655) in DPBS, and incubated overnight at 37 degrees Celsius. On day 0, the Poly-L-Ornithine coated plates were washed three times using DPBS, and the plates were air dried in a 37 degree Celsius incubator until all the DPBS evaporated. Pre-differentiated cells were dissociated and centrifuged as above, and pelleted cells were resuspended in Maturation Medium containing the following: 50% Neurobasal-A medium (GIBCO/Thermo Fisher Scientific; Cat. No. 10888022) and 50% DMEM/F-12 (GIBCO/Thermo Fisher Scientific; Cat. No. 11320033) as the base, 1X MEM Non-Essential Amino Acids, 0.5X GlutaMAX Supplement (GIBCO/Thermo Fisher Scientific; Cat. No. 35050061), 0.5X N-2 Supplement, 0.5X B-27 Supplement (GIBCO/Thermo Fisher Scientific; Cat. No. 17504044), 10 ng/mL NT-3, 10 ng/mL BDNF, 1 ug/mL Laminin mouse protein, and 2 ug/mL doxycycline hyclate. Pre-differentiated cells were subsequently counted and plated at 400,000-450,000 cells per well of a 12-well plate coated with Poly-L-Ornithine in 1 mL of Maturation medium with 20 uM trimethoprim (TMP) (Sigma-Aldrich, Cat No. 92131) to activate the CRISPRa machinery in these cells (TMP stabilizes the degron-tagged CRISPRa machinery). On day 7, half of the medium was removed and an equal volume of fresh Maturation medium without doxycycline was added. On day 14, half of the medium was removed and twice that volume of fresh medium without doxycycline was added. On day 19, neurons were harvested for sc-RNA-seq.

Cell line generation and CRISPRa validation
K562 cells
K562 cells expressing dCas9-VP64 were generated in-house via lentiviral integration of a dCas9-VP64-blast construct7 (Addgene Plasmid #61422) into K562 cells. Cells were selected with 10 ug/mL blasticidin, and polyclonal cells were single-cell sorted into 96-well plates to grow up clonal cell lines expressing dCas9-VP64. Clonal cell lines were tested for CRISPRa activity by testing the ability of a CRISPRa gRNA to activate a minP-tdTomato construct20, and the highest tdTomato expressing cell line was used for experiments. K562 cells expressing dCas9-VPR were purchased from Horizon Discovery/Perkin Elmer (catalog ID: HD dCas9-VPR-005), and these cells were tested for CRISPRa activity using the same tdTomato expression assay described above.
iPSC-derived neurons
Human WTC11 iPSCs equipped with a doxycycline-inducible NGN2 transgene expressed from the AAVS1 safe-harbor locus as well as an ecDHFR-dCas9-VPH construct expressed from the CLYBL safe-harbor locus were a gift from the Kampmann lab6. These cells were tested for CRISPRa activity using the same tdTomato expression assay that was used to validate the K562 cell lines, which is described above.
gRNA selection and design
Enhancer-targeting gRNAs were selected from our CRISPRi library2, 33. Specifically, 50 spacer sequences (2 per candidate enhancer) were randomly selected from the list of 664 significant “hit” enhancer-gene pairs in the at-scale library. Another 50 spacer sequences targeting an additional 25 candidate enhancers (again 2 per candidate enhancer) were randomly selected from candidate enhancer non-hits (i.e., gRNAs from the at-scale library targeting candidate enhancer regions with strong biochemical marks predictive of regulatory activity that did not yield significant downregulation of any neighboring genes in our previous CRISPRi study). An additional 30 TSS-positive control gRNAs were randomly sampled from the top quartile of gRNAs recommended by Horlbeck et al. (hCRISPRa-v2 library)16. 50 NTC negative control spacer sequences were also selected from the hCRISPRa-v2 library16. The 313 candidate promoter targeting gRNAs were either selected from the Horlbeck et al. library16 or designed using FlashFry33 . Briefly, 50 candidate promoters of 9 NDD risk genes (TCF4, FOXP1, SCN2A, CHD8, BCL11A, TBR1, SHANK3, SYNGAP1, ANK2)23, 24 were pulled from Basic GENCODE annotations34 and were filtered for “type” == “transcript” and “transcript_type” == “protein coding”. Separate bed files were generated for all promoter regions defined as the 500bp upstream of each protein coding transcript. Careful attention was paid to the strand orientation of each transcript when annotating promoter regions. Bed files were sorted and merged to combine multiple promoters with >1bp overlap into a single promoter annotation. Transcript bounds provided for each merged promoter begin +1bp from the end of the promoter and end at the position corresponding to the longest transcript mapping to that promoter. NGG-protospacer within these candidate promoters were identified using FlashFry and subsequently scored using default parameters (see FlashFry manuscript and user guide for a complete description of scoring metrics/algorithms)33. A TSS-distance metric was then calculated for each gRNA using human fetal brain 5’ Capped Analysis of Gene Expression (CAGE) data35, 36 obtained from FANTOM (https://fantom.gsc.riken.jp/5/sstar/FF:10085-102B4; CTSS, hg38). First, the strongest FANTOM annotated TSS was identified within each +/-500 bp region up and downstream of each hg38 Gencode Basic protein coding transcript TSS. For regions with a tie between the highest scoring FANTOM TSSs, the TSS position closest to Gencode annotated TSS position was prioritized. Each candidate sgRNA from FlashFry was annotated with the distance to the nearest FANTOM TSS using the command “bedtools closest -a sgRNAs_with_fantom_tss -b strongest_fantom_tss_within_gencode_promoter -D b -t first.” For Gencode Basic protein coding transcripts without a human fetal brain FANTOM peak within 500 +/- bp, the distance of each sgRNA to the nearest Gencode TSS was reported instead. A distance of zero indicates that an sgRNA overlaps with the nearest annotated TSS. Multiple rounds of successively relaxing score and distance thresholds were then iterated until the top 4 gRNAs for each candidate promoter were selected (five selection rounds in total). Optimal TSS-distances were approximated using genome-wide CRISPRa design rules28. gRNAs flagged for potentially problematic polythymidine tracks or GC content were excluded. The gRNA selection criteria used in each round were as follows:
  • Round 1: 1. TSS Distance between -150 and -75 BP 2. Doench2014OnTarget >= 0.2 3. Dangerous_in_genome <= 1 4. Hsu2013 > 80.
  • Round 2: 1. TSS Distance between -400 and -50 BP 2. Doench2014OnTarget >= 0.2 3. Dangerous_in_genome <= 1 4. Hsu2013 > 80.
  • Round 3: 1. TSS Distance between -400 and -50 BP 2. Doench2014OnTarget >= 0.2 3. Dangerous_in_genome <= 1 4. Hsu2013 > 50.
  • Round 4: 1. TSS Distance between -400 and -50 BP 2. Doench2014OnTarget >= 0.2 3. Dangerous_in_genome <= 2 4. Hsu2013 > 50.
  • Round 5: 1. Doench2014OnTarget >= 0.2 2. Dangerous_in_genome <= 2 3. Hsu2013 > 10 4. DoenchCFD_maxOT < 0.95
Complete oligo sequences with gRNA spacers and additional sequences for cloning into piggyFlex are listed in Table S1. Note all gRNAs in our library are designed/modified to start with a G followed by the 19 base pair spacer to facilitate Pol III transcription.
gRNA library cloning into piggyFlex vector
The 493 gRNAs with associated 10N random barcodes were ordered as an IDT oPool and PCR amplified with Q5 High-Fidelity polymerase (NEB, Cat. No. M0491S) to make double stranded DNA. The piggyFlex backbone vector was digested with SalI (NEB, Cat. No. R3138S) and BbsI (NEB, Cat. No. R0539S) in 10X NEBuffer r2 at 37 degrees Celsius overnight to ensure complete digestion of the backbone. This digestion cuts out the EF1a-puro-GFP cassette of the vector which is then added back in a later cloning step. The digestion product was run on a 1% agarose gel in TAE buffer, and the linear backbone vector (5098 base pairs in size) was gel extracted using a gel extraction kit (NEB, Cat. No. T1020S). The second product from the digestion (2878 base pairs) which contains the EF1a-puro-GFP cassette was saved for a later assembly reaction in the final cloning step (described below). The PCR amplified IDT oPool gRNAs with associated 10N random barcodes were cloned into the linear backbone using NEBuilder HiFi DNA Assembly (NEB, Cat. No. E2621S) using 0.15 pmol of the insert (gRNA library) and 0.02 pmol of the linear backbone. Assembled product was transformed into electrocompetent cells (NEB, Cat. No. C3020K) and plasmid DNA was extracted with a midiprep kit (Zymo Research, Cat. No. D4200). The resulting vector was then digested with SapI (NEB, Cat. No. R0569S), for one hour at 37 degrees Celsius. Digested product was cleaned with 0.5X AMPure beads (Beckman Coulter, Cat. No. A63880) and cleaned digested linear backbone was used for a subsequent assembly reaction to add the EF1a-puro-GFP cassette back into the final piggyFlex vector between the gRNA sequence and the 10N random barcode sequences. 0.014 pmol of the linear backbone was assembled with 0.056 pmol of the insert sequence and the assembly reaction was cleaned with a 0.5X AMPure step. The assembled product was transformed into electrocompetent cells and plasmid DNA was extracted with a midiprep kit. The final plasmid library was subsequently PCR amplified and sequenced to ensure that all 493 gRNAs were successfully cloned into the piggyFlex vector. Note: The 10N barcode is an additional gRNA identification strategy that can be used to assign gRNAs to cells, however, we used directly sequenced gRNAs (from the 10x Genomics capture sequence) to identify gRNAs in this work as this more accurately assigns gRNA transcripts to cells37.

Transfection of the gRNA library and selection for transfected cells
K562 cells
16 million K562 cells (8 million K562-VP64 cells and 8 million K562-VPR cells) were transfected with the gRNA library and the piggyBac transposase (System Biosciences, Cat. No. PB210PA-1) at a 20:1 molar ratio of library:transposase using a Lonza 4D nucleofector and the Lonza nucleofector protocol for K562 cells. The 16 million cells were split across 8 100 uL nucleofection cartridges, with each individual nucleofection cartridge receiving 2 million cells and 2 ug of total DNA. After nucleofection, cells were transferred to pre-warmed RPMI media in a cell culture flask and incubated at 37 degrees Celsius. One day after transfection, cells were selected with 2 ug/mL puromycin (GIBCO/Thermo Fisher Scientific; Cat. No. A1113803). After 9 days, cells were harvested for single-cell transcriptome profiling.
Induced pluripotent stem cells
6 million dCas9-VPH iPSCs (same cells as described above) were transfected with the gRNA library and the piggyBac transposase at a 5:1 molar ratio of library:transposase using the Lonza nucleofector and the Lonza nucleofector CB-150 program. The 6 million cells were split across 6 100 uL nucleofection cartridges, with each individual nucleofection cartridge receiving 1 million cells and 17.5 ug of total DNA. After nucleofection, cells were transferred to pre-warmed mTeSr Plus basaI medium with ROCK inhibitor in a cell culture flask and incubated at 37 degrees Celsius. One day after transfection, cells were selected with 20 ug/mL puromycin (note: the AAVS1-NGN2 construct has a puromycin resistance cassette on it, so a higher dose of puromycin was used to successfully select for cells that received a gRNA in the presence of an existing puromycin resistance cassette). Media changes were performed daily (mTeSr Plus basaI medium with ROCK inhibitor and 10 ug/mL puromycin) for seven days prior to initiating neuron differentiation (described in “Human iPSC-derived neuron cell culture and differentiation” methods section).
10x Genomics sc-RNA-seq with associated gRNA transcript capture
K562 screen
Cells were harvested and prepared into single-cell suspensions following the 10x Genomics Single Cell Protocols Cell Preparation Guide (Manual part number CG00053, Rev C). Four lanes were used for the single-cell transcriptome profiling, with two lanes containing cells from the K562-VP64 cell line, and two lanes containing cells from the K562-VPR cell line. Roughly 10,000 cells were captured per lane of a 10x Chromium chip (Next GEM Chip G) using Chromium Next GEM Single Cell 3ʹ Reagent Kits v3.1 with Feature Barcoding technology for CRISPR Screening (10x Genomics, Inc, Document number CG000205, Rev D).
iPSC-derived neuron screen
iPSC-derived neurons were harvested and prepared into single-cell suspensions following a published protocol 38. Cells were split into two batches, with one batch going through a fluorescence-activated cell sorting (FACS) step to sort on the top 40% of green fluorescent protein (GFP) expression to enrich for neurons with greater numbers of gRNAs integrated, and the second batch going directly into the 10x Genomics single-cell library preparation protocol. Sorting on the top 40% of GFP expression resulted in a two-fold increase in the mean number of gRNAs integrated in those cells as compared to unsorted cells. Four lanes were used for the single-cell transcriptome profiling, with two lanes containing GFP-positive sorted cells, and two lanes containing unsorted cells. Roughly 13,000 cells were captured per lane of a 10x Chromium high-throughput chip (Next GEM Chip M) using Chromium Next GEM Single Cell 3’ HT Reagent Kits v3.1 (Dual Index) with Feature Barcode technology for CRISPR Screening (10x Genomics, Inc, Document number CG000418, Rev C).
Sequencing of scRNA-seq libraries
Final libraries were sequenced on a NextSeq 2000 P3 100 cycle kit (R1:28 I1:10, I2:10, R2:90) for each screen (K562 and iPSC-derived neuron screens). Gene expression and gRNA transcript libraries were pooled at a 4:1 ratio for sequencing.
Transcriptome data processing and quality control filtering for K562 and iPSC-derived neuron screens
CellRanger version 6.0.1 was used to perform bcl2fastq and count matrix generation. CellRanger mkfastq was run using default parameters, and CellRanger count was run using the GRCh38-3.0.0 reference transcriptome from 10x Genomics and default parameters. For the K562 screen, cells with greater than 10% mitochondrial reads and less than 4000 UMIs were filtered out. For the iPSC-derived neuron screen, cells with greater than 17% mitochondrial reads and less than 1500 unique molecular identifiers (UMIs) were filtered out. After quality control filtering, 33,944 cells were retained in the K562 screen, and 51,183 cells were retained in the iPSC-derived neuron screen. The resulting count matrix output after this filtering was used for all downstream analyses.
Neuron differentiation transcriptome projection
Single-cell transcriptome data from a time course study of iPSC-derived neurons26 was downloaded from https://www.ebi.ac.uk/biostudies/arrayexpress/studies/E-MTAB-10632 (Accession No. E-MTAB-10632, matrices_timecourse.tar.gz), and integrated with the neuron CRISPRa screening dataset described here. Seurat v4 was used for all data analyses39. The CRISPRa dataset was randomly downsampled to 5,000 cells for this analysis. Count matrices from both matrices were filtered to include only shared genes from the two datasets (n=14,777 genes). SelectIntegrationFeatures() and FindIntegrationAnchors() were run using default parameters to identify anchors for integration. 20,606 anchors were found and 2,953 anchors were retained for data integration. IntegrateData() was run using the retained 2,953 anchors to integrate the two datasets. After integration, standard Seurat single-cell analysis was performed to scale the data, and run the PCA and UMAP algorithms.
gRNA assignment and differential gene expression testing
Genomic coordinates (hg38) for final gRNA spacers were isolated using a loop built around the matchPattern() function from the BSgenome package40. A 2Mb window (1Mb upstream and downstream) around each gRNA was then calculated and all genes within the 2Mb window were isolated using a loop built around ENSEMBL biomaRt getBM() function41, 42. These 1Mb neighboring gene sets were then filtered to unique entries (unique HGNC symbols) for compatibility with the Seurat FindMarkers() function used in DE testing.
A global UMI filter of 5 gRNA UMIs/cell was used to assign gRNAs to single cell transcriptomes for both K562 and iPSC- derived neuron datasets (note this heuristic threshold was chosen based on manual inspection of the UMI count distributions for each gRNA and prior work)2. gRNA UMI counts for each cell were derived from the count matrix of passing cells output by CellRanger (which applies an automatic total UMI threshold to cells) and which also passed QC.
Expression of a given gene within 1Mb of the gRNA of interest was compared between all cells with a given gRNA and all other cells as control. log2() fold changes in expression for a given gene were calculated using the Seurat FindMarkers() function with the following arguments: ident.1 = gRNA_Cells, ident.2 = Control_Cells, min.pct = 0, min.cells.feature = 0, min.cells.group = 0, features = target_gene, logfc.threshold = 0. A Wilcoxon rank-sum test was used to generate raw differential expression P-values. This process was then iterated for all genes within 1Mb of all gRNAs. NTCs were tested against all genes within 1Mb of any targeting gRNA. Only tests involving genes detected in >0.2% of test gRNA and control cells were carried forward.
These raw differential expression P-values were then used to calculate empirical P-values to call EFDR < 0.1 sets2. Specifically, an empirical P-value was calculated for each gRNA-gene test as:



Empirical P-values were then Benjamini-Hochberg corrected, and those < 0.1 were kept for 10% EFDR sets. Log2 fold changes between gRNA and control cells were visualized using the gviz package43 along with tracks for RefSeq transcripts (ENSEMBL biomaRt), H3K27ac, and ATAC seq peaks. The K562 ATAC and H3K27ac data were downloaded from ENCODE 44. ATAC-seq and H3K27ac CUT&RUN data from 7-8 week old NGN2-iPSC inducible excitatory neurons was obtained from Song et al. 201932. As previously described, ATAC-seq and CUT&RUN reads were trimmed to 50bp using TrimGalore with the command --hardtrim5 50 before alignment (https://github.com/FelixKrueger/TrimGalore). ATAC-seq reads were realigned to hg38 using the standard Encode Consortium ATAC-seq and ChIP-seq pipelines respectively with default settings and pseudo replicate generation turned off. Trimmed, sorted, duplicate and chrM removed ATAC-seq bam files from multiple biological replicates were combined into a single bam file using samtools merge v1.1045. Trimmed CUT&RUN reads were realigned to hg38 using Bowtie2 v2.3.5.1 with the following settings -- local --very-sensitive-local --no-mixed --no-discordant -I 10 -X 700 and output sam files were convert to bam format using samtools view45, 46. Duplicated reads were removed from the CUT&RUN bam file using Picard MarkDuplicates v2.26.0 with the --REMOVE_DUPLICATES =true and --ASSUME_SORTED=true options (http://broadinstitute.github.io/picard/). Finally, bam files were converted using the bedtools genomecov followed by the UCSC bedGraphToBigWig utility.
Singleton replication and validations with bulk RNA-sequencing
To replicate and validate a gRNA’s ability to upregulate its target gene outside of the pooled screening format, we generated individual, polyclonal cell lines that each expressed a single gRNA from a chosen representative set of gRNAs (Supplementary Data 15). This representative gRNA set was chosen to validate gRNAs that upregulate their targets in a cell-type specific manner (TBR1 is neuron-specific; ASIC1 and ANXA1 are enhancer targeting gRNAs that are K562-specific) and to validate promoter targeting gRNAs that are able to upregulate their targets in both cell types (e.g. BCL11A, TCF4, and FOXP1). gRNAs were ordered in two Oligo Pools (Integrated DNA Technologies), with each gRNA bearing a unique handle sequence that was used to uniquely PCR amplify out individual gRNA oligos (Supplementary Data 15). gRNAs were individually cloned into the piggyFlex vector exactly as described in the “gRNA library cloning into piggyFlex vector” methods section above, with the only difference being that the 10 N barcode was not included in the oligo design for these validation oligos. After cloning, the gRNA sequences in the piggyFlex vectors were sequence verified to ensure correct insertion of the gRNA sequences.
PiggyFlex constructs containing gRNA sequences were transfected into K562 cells and iPSCs with the Lonza 4D nucleofector (using the K562 protocol for K562 cells, and the CB-150 program for the iPSCs). 525 ng of total DNA (using a 5:1 molar ratio of piggyFlex vector and transposase vector) was transfected into three replicates of 30,000 cells each. After transfection, cells were seeded into 48-well plates for culture. One day later, 2 ug/mL (for K562 cells) and 20 ug/mL (for iPSCs) puromycin (GIBCO/Thermo Fisher Scientific; Cat. No. A1113803) was added to the cultures to select for successfully transfected cells. Daily media changes were performed (with puromycin) to continually select cells for seven days. After seven days of selection, K562 cells were lysed with TRIzol (Invitrogen, Cat. No. 15596026). Samples were frozen in TRIzol reagent at −20C, and RNA was extracted using the Direct-zol RNA miniprep kit (Zymo Research, Cat. No. R2050). After puromycin selection, iPSCs were differentiated into neurons exactly as described in the “Human iPSC-derived neuronal cell culture, differentiation, and CRISPRa induction” section. iPSC-derived neurons were differentiated for eight days prior to TRIzol lysis and RNA extraction as described above for K562 cells.
RNA-sequencing libraries were prepared using an in-house library preparation method. 30–50 ng of RNA was used as input for each library. RNA was reverse transcribed using indexed oligo dT primers (ACGACGCTCTTCCGATCTNNNNNNNNAGAGAACTTGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN), template switching oligo (AAGCAGTGGTATCAACGCAGAGTGAATGGG), and Template Switching RT Enzyme Mix protocol from NEB (New Engand Biolabs, Cat. No. #M0466L). cDNA was PCR amplified using the NEBNext High-Fidelity 2X PCR Master Mix (New England Biolabs, Cat. No. M0541) with the following forward and reverse primers: ACGACGCTCTTCCGATC (forward), AAGCAGTGGTATCAACGCA (reverse). SYBR Green (Thermo Fisher Scientific, Cat. No. S7567) was added to track the amplification curve and proper PCR cycle number. PCR amplified cDNA was purified with 1X AMPure beads (Beckman Coulter, Cat. No. A63882), washed twice with 70% ethanol, eluted in 20 uL of nuclease-free water and loaded on an Agilent Tapestation using D5000 reagents (Agilent Technologies, Cat. No. 5067-5589) and the corresponding screentape (Agilent Technologies, Cat. No. 5067-5588). 30–50 ng of purified PCR amplified cDNA was fragmented using an i7 loaded Tn5 transposase similar to the process described by Cao et al. 41. To load the transposase, we followed the manufacturer’s protocol to load unloaded transposase (Diagenode, Cat. No. C01070010-20). Tagmented DNA was PCR amplified using NEBNext High-Fidelity 2X PCR Master Mix (New England Biolabs, Cat. No. M0541) with indexed primers (CAAGCAGAAGACGGCATACGAGATNNNNNNNNNNGTCTCGTGGGCTCGG and AATGATACGGCGACCACCGAGATCTACACNNNNNNNNNNACACTCTTTCCCTACACGACGCTCTTCCGATCT) following previously described PCR conditions by Cao et al. 41. This PCR adds sample-specific indices and P5 and P7 Illumina sequencing adapters. Libraries were cleaned using a 1X AMPure bead cleanup (Beckman Coulter, Cat. No. A63882), and quantified on an Agilent TapeStation using D1000 reagents (Agilent, Cat. No. 5067-5583) and the corresponding screentape (Agilent, Cat. No. 5067-5582). For sequencing, libraries were diluted to 2 nM and pooled equimolarly, and then diluted to a loading concentration of 650 pM. Libraries were sequenced on an Illumina NextSeq 2000 using P1 100 cycle kits (R1: 18, I1:10, I2: 10 (optional), and R2:110). Transcript and gene-level quantifications were performed using kallisto57. Prior to transcript quantification, reads were downsampled to the minimum number of reads observed for a sample to control for differences in sequencing depth. DESeq258 was used to quantify expression changes for all genes within 1 Mb of the gRNA target site and genome wide. Genome-wide differential analyses were conducted using default parameters. Target gene expression was compared between gRNA cells and control cells using a two-tailed Wilcoxon rank-sum test with a significance threshold of 0.1 (mirroring single-cell analysis framework described above). Gviz was used to visualize differential expression testing results alongside tracks for neighboring genes (ENSEMBL biomaRt) as described above.