Feb 26, 2023
mcSCRB-seq2 protocol
- 1Ludwig-Maximilians-Universität München
Protocol Citation: Lucas Esteban Wange, Johannes JWB Bagnoli, Aleksandar Janjic, Wolfgang Enard 2023. mcSCRB-seq2 protocol. protocols.io https://dx.doi.org/10.17504/protocols.io.n92ldyer9l5b/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We used this protocol and it's working.
Created: June 16, 2020
Last Modified: May 18, 2026
Protocol Integer ID: 38211
Keywords: RNA-seq, transcriptomics, SCRB-seq, single cell RNA-seq, mcSCRB-seq, seq2 protocol mcscrb, prime gene expression layout, additional dctp in the reverse transcription, robust against rnase, tera polymerase, kapahifi for preamplification, seq2, reverse transcription, mcscrb, primer concentration in preamp, rnase, seq, seq for more information, option for cheaper library prep, crowding scrb
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK
The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
mcSCRB-seq2 is the improved version of our published protocol molecular crowding SCRB-seq (mcSCRB-seq) (https://www.nature.com/articles/s41467-018-05347-6/).
Following changes were introduced:
- re-evaluted the Lysis Buffer formulation, making it more robust against RNAses
- added additional dCTP in the Reverse Transcription leading to higher yield by enhanced Template switching
- updated the oligo dT primers to be compatible with 10x's three prime gene expression layout (see prime-seq for more information)
- changed to KapaHifi for PreAmplification as it produces less chimeric rerads compared to Tera Polymerase
- increased Primer concentration in PreAmp (SingV6)
- included an option for cheaper library prep with NEBNext
Guidelines
- All reagents and plasticware can be found in the 'Materials' section.
- Use only RNase free supplies and clean all surfaces and tools with RNase Away prior to working
- Make sure all steps before reverse transcription are carried out swiftly and on ice.
- All primer sequences are listed below:
| A | B | C | D | E | |
| Oligo | Vendor | Purification | Concentration | Sequence | |
| barcoded oligo-dT (E3V7NEXT) | Sigma | Cartridge | 2 µM | ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC12][UMI16][T30]VN | |
| TSO unblocked (E5V7NEXT) | Sigma | RNase-Free HPLC | 100 µM | Biotin-ACACTCTTTCCCTACACGACGCrGrGrG | |
| PreAmp (SINGV6) | IDT | Desalted | 10 µM | Biotin-ACACTCTTTCCCTACACGACGC | |
| 3' enrichment primer (P5NEXTPT5) | IDT | HPLC | 5 µM | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T | |
| i7 Index Primer (Nextera) | IDT | TruGrade | 5 µM | CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG | |
| i5 Index Primer (TruSeq) | IDT | Trugrade | 5µM | AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCTCTTCCGATCT |
Specific barcoded oligodT (E3V7NEXT) sequences:
E3V7_Set1.txt E3V7_Set2.txt Materials
General:
RNase AWAY™ Surface DecontaminantCarl RothCatalog #A998.4
Ethanol (100%, Molecular Biology Grade)Fisher ScientificCatalog #BP2818500
UltraPure™ DNase/RNase-Free Distilled WaterThermo Fisher ScientificCatalog #10977023
Quant-iT™ PicoGreen® dsDNA Assay KitLife TechnologiesCatalog #P11496 or QuantiFluor(R) dsDNA SystemPromegaCatalog #E2670
Homemade Beads:
Sera-Mag SpeedBeads Carboxylate-Modified Magnetic ParticlesGE HealthcareCatalog #44152105050350
Sodium ChlorideFisher ScientificCatalog #S271 Tris HCl Buffer 1M Solution, Sterile pH 8.0Bio Basic Inc.Catalog #SD8127.SIZE.450ml EDTA (0.5 M), pH 8.0Life TechnologiesCatalog #AM9260G IGEPAL-CA630Merck MilliporeSigma (Sigma-Aldrich)Catalog #I3021 SIGMA-ALDRICH Sodium AzideMerck MilliporeSigma (Sigma-Aldrich)Catalog #S2002-100G
Lysis:
Phusion HF Buffer Pack - 6.0 mlNew England BiolabsCatalog #B0518S
NxGen RNAse InhibitorLucigenCatalog #30281-2
Reverse Transcription:
PEG 8000Merck MilliporeSigma (Sigma-Aldrich)Catalog #81268 Maxima H Minus Reverse TranscriptaseThermo Fisher ScientificCatalog ##EP0741 dNTP Set 100 mM SolutionsThermo Fisher ScientificCatalog #R0181 dCTP Solution (100 mM)Thermo Fisher ScientificCatalog #R0151
ERCC RNA Spike-In MixThermo FisherCatalog #4456740 (optional)
Exonuclease I (E.coli) - 15,000 unitsNew England BiolabsCatalog #M0293L
PreAmp:
Kapa HiFi Hotstart ReadyMix (2x)Kapa BiosystemsCatalog #KK2612
Library:
Bioanalyzer chips and reagents (DNA High Sensitivity kit)Agilent Technologies NEBNext Ultra II DNA Library Prep with Sample Purification Beads - 96 rxnsNew England BiolabsCatalog #E7103L NEBNext Q5 Hot Start HiFi PCR Master Mix - 250 rxnsNew England BiolabsCatalog #M0543L
SPRIselect reagentGE HealthcareCatalog #B23317
Before start
Wipe bench surfaces with RNAse Away and keep working environment clean.
Sample Collection
Prepare Lysis Buffer for the number of plates you intend to use.
| A | B | C | |
| Reagent | per well | per plate (96 well) | |
| Buffer Phusion HF 5x | 0.008 | 0.88 | |
| NxGen RNAi (40U/ul) | 0.125 | 13.75 | |
| H2O | 3.867 | 425.37 | |
| Total | 4 | 440 |
Lysis Buffer PPi (Primer, Phusion and inhibitor)
Distribute 4 µL PPi Lysis Buffer per well using a repeater pipette (stepper) or similar.
Add 1 µL barcoded oligo-dT primer [2 μM] (E3V7) to each well using a multichannel pipette.
Note
When preparing many plates at once we usually make one master plate including the primers and then distribute 5 µL to each well of the Lysis plates.
Lysis plates with barcode primers can be prepared ahead of time and stored at -20 °C for short term (< 1 week).
Deposit one cell per well in the Lysis plate using e.g. FACS
Note
Keep plate cooled whenever possible, briefly spin down before use to make sure lysis buffer is at the bottom of the well.
Immediately after sorting close plate tightly with an aluminum seal.
In a cooled centrifuge, spin down the plate 1000 x g, 4°C, 00:00:30 , max speed if 1000 x g are not possible and place immediately on dry ice.
Store plates at -70 °C or lower for up to 6 month before processing.
30s
Preparation
Before starting clean all surfaces and pipettes with RNase Away.
Apply RNase Away for 3-5 minutes and wipe away with a clean tissue.
When running the protocol for the first time, prepare Cleanup Beads as described in Appendix 1.
Note
The Cleanup Beads can be stored at 4 °C for up to six months and do not have to be prepared fresh every time.
When running the protocol for the first time, prepare Pooling Beads as described in Appendix 2.
Note
The Pooling Beads can be stored at 4 °C for up to six months and do not have to be prepared fresh every time. Pooling Beads contain a 5 times lower amount of Bead particles and can alternatively be prepared by diluting Cleanup Beads 1/5 in Bead Binding Buffer ( see Table in the corresponding section, add H2O to 50 ml)
Reverse Transcription
Note
When processing several plates for an experiment, try to balance the different conditions to be able to correct for potential batch effects. In the ideal case process all plates in one go. However, for the first steps until pooling of the cDNA you will need one Thermal Cycler per plate, so depending on the number of available Thermo Cyclers, batches can be bigger or smaller.
Prepare Reverse Transcription Mix
| A | B | C | |
| Reagent | Well | Plate | |
| UltraPure Water | 0.7 µL | 77 µL | |
| PEG 8000 (50% solution) | 1.5 µL | 165 µL | |
| Maxima RT Buffer (5x) | 2 µL | 220 µL | |
| dNTPs (25 mM) | 0.4 µL | 44 µL | |
| dCTPs(100 mM) | 0.2 µL | 22 | |
| TSO E5V7NEXT (100 µM) | 0.1 µL | 11 µL | |
| Maxima H Minus RT (200 U/µL) | 0.1 µL | 11 µL | |
| Total | 5 µL | 550 µL |
If you wish to add spike-in molecules like ERCCs or molecular spikes add them to the RT Mix and decrease the water accordingly
Note
Caution: Reverse Transcription Mix with PEG needs to be mixed carefully! RT Mix should be kept on ice until use but not longer than 00:15:00 minutes
Gently thaw plates on ice for 00:01:00 at most.
1m
Spin down in a pre-cooled centrifuge 1000 rcf, 4°C, 00:00:30 .
30s
Add 5 µL Reverse Transcription Mix to each well using a repeater pipette or a liquid handling robot like the Mantis.
Incubate for 01:30:00 at 42 °C in a Thermal Cycler with heated lid 105 °C .
cDNA Pooling & Purification
Mix each well (10 µL per well) with 10 µL of Pooling Beads for a 1:1 ratio. Pooling Beads can be added using a repeater pipette.
Note
The EDTA in the Pooling Beads will inactivate the RT and make pooling easier due to the color.
Pool all wells of one plate into a 2 mL tube or 15 mL tube when pooling up to 384 cells.
Note
We usually transfer all wells of a 96 well plate into the first column using a 20 µL 8-channel pipette and then transfer everything to a bigger tube using a 200 µL pipette.
Incubate for 00:05:00 at Room temperature to allow binding of the first strand cDNA onto beads.
Place the tube on the magnet stand until clear, approximately 00:05:00 and discard supernatant.
5m
Wash with 1 mL of 80% EtOH while the tube is on the magnet. Discard the supernatant.
Note
Volume of EtOH should be adjusted depending on the number of cells/plates in a pool. More samples will require more EtOH to cover the beads completely and wash them efficiently.
Repeat wash step once more.
Air dry beads for 00:05:00
Note
Depending on temperature and humidity, the beads may dry faster. Therefore it is important to regularly check the beads and avoid over-drying.
Resuspend the beads in 17 µL of UltraPure Water and remove from Magnet.
Incubate for 00:05:00 at RT and place on magnet to transfer supernatant to a new well of a 96 well PCR plate.
5m
Exonuclease I Treatment
Add 2 µL of Exonuclease I Buffer (10x) and 1 µL of Exonuclease I per pool.
Note
The Exonuclease I step is important to remove remaining single stranded oligo dT primers. When not removed completely oligo dT primers will prime in the subsequent PCR and thus lead to extremly high levels of cross contamination and inflation of UMI counts!
Incubate as follows in a Thermal Cycler with heated Lid 105 °C :
| Step | Temperature | Time | |
| Incubation | 37 C | 20 min | |
| Heat Inactivation | 80 C | 10 min | |
| Storage | 4 C | ∞ |
Exonuclease I digest
Mix sample with 20 µL Clean Up Beads (22% PEG) for a ratio of 1:1
Note
This Clean up is necessary because the Exonuclease Reaction inhibits the Kapa HiFi polymerase. As this clean up is done on the pooled cDNA the loss of molecules is negligible.
Incubate for 00:05:00 at 20 °C (Room Temp)
Place the plate on the magnet stand until clear (~00:05:00 ) and discard supernatant.
5m
Wash with 100 µL of 80% EtOH while the plate is on the magnet.
Discard the supernatant and keep plate on the magnet.
Repeat wash step once more.
Air dry beads for 00:05:00
Note
Depending on temperature and humidity, the beads may dry faster. Therefore it is important to regularly check the beads and avoid over-drying.
Remove the plate from the magnet and resuspend the beads in 20 µL of UltraPure Water.
Incubate for 00:05:00 at RT and place on magnet to transfer supernatant to a new well.
Full length cDNA Amplification
Prepare Pre Amplification Mix. Adjust to the number of pools.
| Reagent | 1x | |
| KAPA HiFi 2x RM | 25 µL | |
| SINGV6 Primer (10 uM) | 3 µL | |
| UltraPure Water | 2 µL | |
| Total | 30 µL |
Pre Amplification PCR Master mix for one pool.
Add 30 µL Pre Amplification Mix to each pool.
Incubate the Pre Amplification PCR as follows:
| A | B | C | D | |
| Step | Temperature | Time | Cycles | |
| Initial Denaturation | 98 C | 3 min | 1 cycle | |
| Denaturation | 98 C | 15 sec | 15 cycles* | |
| Annealing | 65 C | 30 sec | ||
| Elongation | 72 C | 4 min | ||
| Final Elongation | 72 C | 10 min | 1 cycle | |
| Storage | 4 C | ∞ |
Note
Adjust the number of cycles based on input (cell number and expected amount of RNA per cell).
15 cycles is a good starting point for one full 96 well plate containing big cells like iPSCs. For immune cells increase cycle number to 17-19 cycles.
cDNA Bead Purification
Mix sample with 40 µL Clean Up Beads (22% PEG) for a ratio of 1:0.8
Incubate for 00:05:00 at 20 °C (Room Temp)
Place the plate on the magnet rack until clear (~00:05:00 ) .
5m
Discard supernatant and keep plate on the magnet.
Wash with 100 µL of 80% EtOH while the plate is on the magnet.
Discard supernatant and keep plate on the magnet.
Repeat wash step once more.
Air dry beads for 00:05:00
Note
Depending on temperature and humidity, the beads may dry faster. Therefore it is important to regularly check the beads and avoid over-drying.
Remove from Magnet and resuspend the beads in 10 µL of UltraPure Water.
Incubate for 00:05:00 at RT and place on magnet to transfer supernatant to a new well.
Note
Safe Stoping Point! The Pre-Amplified cDNA can be stored for up to one week at -20 °C . However usually we want to know if the experiment worked first and continue to do the concentration measurement and Bioanalyzer QC.
cDNA Quantification and Quality Check
Quantify the cDNA using the Quant-iT PicoGreen dsDNA assay kit or equivalent following the manufacturer's protocol. Use 1 μl of clean cDNA for quantification.
Quality check the cDNA using the Agilent 2100 Bioanalyzer with High Sensitivity DNA Analysis Kits. Other instruments like the Tape Station or the Fragment Analyzer can be used as well but make sure to not waste more than 4 µL of your cDNA.
Note
Passing the cDNA quality check does not guarantee that the data will be of high quality, however, if the cDNA fails the quality check it will usually not yield good libraries and will therefore generate lower quality data.
Expected result
Exemplary cDNA trace with a peak around 1000 to 1500 bp and few small fragments below 300 bp.
Note
In previous versions of SCRB-seq/mcSCRB-seq we used the Nextera XT Kit for Library Preparation, but have switched to using NEB Next Ultra II recently. While the data quality is similar, the downscaled NEB Next Ultra II Kit as we use it is a fraction of the cost per library and allows for using more of the cDNA as input. However both methods can be used depending on availability of the kits in the lab.
Library Preparation
Use one fourth of your cDNA 2.5 µL but not more than 20 ng in total . If your cDNA concentration is higher than 8 ng/µL, dilute accordingly.
Note
As the volumes in the scaled down NEBNext Ultra II kit are very low we recommend always preparing a 2x master mix for all subsequent steps.
Library Preparation - Fragmentation
Start by setting up the Thermo Cycler to be able to immediately proceed to the incubation after adding the Fragmentation Mix to the cDNA.
Note
Set heated lid to 75° C. Make sure the lid is at the correct temperature before you start the reaction.
Skip the first incubation step once you have added your samples.
| A | B | C | |
| Step | Temperature | Time | |
| Pre-Cool | 4 °C | infinite | |
| Fragmentation | 37 °C | 5 min | |
| A Tailing and Phosphorylation | 65 °C | 30 min | |
| Storage | 4 °C | infinite |
Prepare Fragmentation Mix
| A | B | |
| Reagent | 2x | |
| Ultra II FS Reaction Buffer | 2.8 µL | |
| Ultra II FS Enzyme Mix | 0.8 µL | |
| TE | 3.4 µL | |
| Total | 7 µL |
Note
Ensure that the Ultra II FS Reaction Buffer is completely thawed. If a precipitate is seen in the buffer, pipette up and down several times to break it up, and quickly vortex to mix. Place on ice until use.
Vortex the Ultra II FS Enzyme Mix for 5-8 seconds prior to use for optimal performance.
Add 2.5 µL of cDNA (between 0.5 & 8 ng/µl) to a new well of a 96 well plate and add 3.5 µL of Fragmentation Mix.
Vortex the Fragmentation Mix for 00:00:05 and immediately proceed to next step.
Safety information
Proceed to next step immediately to avoid over-fragmentation.
5s
Place plate containing the samples into Thermal Cycler and start incubation by skiping the initial 4 °C hold.
Library Preparation - Adapter Ligation
Prepare Adapter Ligation Mix:
| A | B | |
| Reagent | 1 x | |
| Ultra II Ligation Master Mix | 6 µL | |
| Ultra II Ligation Enhancer | 0.2 µL | |
| prime Adapter (1.5 µM) | 0.5 µL | |
| Total | 6.7 µL |
Adapter Ligation mix for one Library.
Add 6.7 µL Adapter Ligation Mix to each replicate.
Incubate for 00:15:00 at 20 °C
Note
Turn off heated lid or run cycler with open lid.
15m
Library Preparation - Double size selection
Add 37.3 µL Buffer EB to Samples for a total of 50 µL
Mix Index PCR with 25 µL SPRI select beads (ratio of 0.5x).
Note
We use SPRI Select Beads here instead of our home made 22% Clean Up beads for their guaranteed QCed size selection properties.
Incubate for 00:05:00 at room temperature.
5m
Place the plate on the magnet stand until clear and transfer 75 µL supernatant to a clean well.
Safety information
Be careful not to discard the supernatant! This is your library!
Mix supernatant with 10 µL SPRI select beads (ratio of 1:0.7)
Incubate for 00:05:00 at Room temperature
5m
Place the plate on the magnet stand until clear.
Discard supernatant and keep plate on magnet.
Wash with 150 µL of 80% EtOH while the plate is on the magnet.
Discard the supernatant and keep plate on magnet.
Repeat wash step once more.
Air dry beads for 00:05:00
Note
Depending on temperature and humidity, the beads may dry faster. Therefore it is important to regularly check the beads and avoid over-drying.
5m
Take plate off the magnet and resuspend samples in 10.5 µL 0.1X TE (dilute 1X TE Buffer 1:10 in water).
Elute for 00:05:00 minutes.
5m
Place plate on magnet and transfer samples to clean wells.
Library Preparation - Library PCR and Indexing
Note
For Illumina sequencers with patterned flow cells (e.g. Nova-seq or Next-seq Series) it is recommended to use unique dual indexing, meaning both the i5 and i7 indices are used for only one library. Library replicates may have the same indices.
Add 1 µL of Nextera i7 Index Primer (5 micromolar (µM) ) to each well.
Add 1 µL of TruSeq i5 Index Primer (5 micromolar (µM) ) to each well.
Add 12.5 µL of 2x Q5 Master Mix (NEBNext Ultra II) to each well.
Note
Although scaled down, there will not be sufficient Q5 Master Mix (M0544L) in the kit. This item will have to be ordered separately.
Incubate Library PCR reaction as follows with the heated Lid set to 105 °C :
| A | B | C | D | |
| Step | Temperature | Time | Cycles | |
| Initial Denaturation | 98 °C | 30 sec | ||
| Denaturation | 98 °C | 10 sec | 10* | |
| Annealing/Elongation | 65 °C | 1 min | 10* | |
| Final Elongation | 65 °C | 5 min | ||
| Storage | 8 °C | ∞ |
Library Amplification PCR
Adjust the number of cycles based on total cDNA input.
As a general guide we recommend:
| A | B | |
| Input (ng) | Cycles | |
| 20 | 10 | |
| 10 | 11 | |
| 5 | 12 | |
| 2.5 | 13 |
Library Preparation - Final Double Size Selection and Clean Up
Add 25 µL Buffer EB to Index PCR.
Mix Index PCR with 25 µL SPRI select beads (ratio of 1:0.5)
Incubate for 00:05:00 at Room temperature
5m
Place the plate on the magnet stand until clear and transfer 75 µL supernatant to a clean well.
Safety information
Be careful not to discard! This is your library.
Mix supernatant with 10 µL SPRI select beads (ratio of 1:0.7)
Incubate for 00:05:00 at Room temperature .
5m
Place the plate on the magnet stand until clear.
Discard supernatant and keep plate on the magnet.
Wash with 150 µL of 80% EtOH while the plate is on the magnet.
Discard supernatant and keep plate on the magnet.
Repeat wash step once more.
Air dry beads for 00:05:00 .
Note
Depending on temperature and humidity, the beads may dry faster. Therefore it is important to regularly check the beads and avoid over-drying.
5m
Elute in 15 μl UltraPure Wate r. 107 Incubate for 00:05:00 and then place on magnet until clear. Transfer eluted library to new well. Stopping point. The libraries can be safely stored at -20 °C until they will be QCed and sequenced. Library QC 45m
Take plate off the magnet and resuspend samples in 15 µL UltraPure Water.
Elute for 00:05:00 minutes.
Transfer 15 µL clean sequencing Library to a 0.5 mL tube for storage.
Note
Safe Stopping Point! The final library can be stored at -20 °C until sequencing ideally not longer than one month.
Library Preparation - Quantification and QC
Quantify the cDNA using the Quant-iT PicoGreen dsDNA assay kit or equivalent following the manufacturer's protocol. Use 1 µL of the final Library for quantification.
Note
Expected Library concentrations are between 1 and 10 ng/µl. Very low yield can be an indicator of low quality cDNA. For Yields between 0.1 and 1 ng/µl consider Amplifying the Library for 5 to 10 more Cycles using the Q5 Master Mix with universal Illumina Fwd and Rev. primers. (see Materials)
Quality control and Quantify the Library using the Agilent 2100 Bioanalyzer with High Sensitivity DNA Analysis Kits. Other instruments like the Tape Station or the Fragment Analyzer can be used as well.
Note
Use Library concentrations between 1 and 2 ng/µL for optimal quantification results. If Library concentration is above 2 ng/µl dilute accordingly.
Expected result
Optimal Bioanalyzer trace of an NEB Next Library. Narrow distribution with a peak between 300 and 400 bp. If the Fluorescence intensity maximum is markedly higher than the Marker peaks (35bp and ~10000 bp) the quantification of the Bioanalyzer will be inaccurate. The trace in the example is still in a quantifiable range.
Quantify the Library Molarity using the Bioanalyzer2000 (or else) software. Make sure to set the Region from 200 bp to 1000 bp. The Bioanalyzer will calculate the Molarity based on fragment size and Fluorescence intensity.
We usually aim for a Library concentration of 10nM (10000pM) to submit for sequencing. Lower or higher molarities might be required depending on the sequencing provider.
Sequencing
Samples should be submitted according to your Sequencing Facility specifications. prime-seq is compatible with Illumina Sequencing.
At least 8 cycles are required for the Index Reads (i7+i5) and 28 cycles for the Read 1 (BC+UMI). Read 2 (DNA) should be adjusted based on the quality of the genome being mapped to, but for human and mouse 50 cycles are sufficient.
Some potential sequencing options:
| A | B | C | D | E | F | |
| Sequencer | Read1 | Read2 | Index Read (i7) | Index Read (i5) | Kit | |
| NovaSeq 6000 | 28 | 94 | 8 | 8 | SP v1.5 100 cycle | |
| NovaSeq 6000 | 150 | 150 | 10 | 10 | S4 v1.5 300 cycle | |
| NextSeq 500/550 | 28 | 63 | 8 | 8 | NextSeq 500/550 HiOut v3 75 cycle | |
| NextSeq 1000/2000 | 28 | 88 | 8 | 8 | NextSeq 1000/2000 P2 100 cycle | |
| NextSeq 2000 | 28 | 46 | 8 | 0 | NextSeq 2000 P3 50 cycle |
NextSeq 2000 P3 50 Cycle is only possible when not pooling with other libraries as no index read is included.
Sequencing Depth should be adjusted to the scientific question, for example for broad cell type classification few read per cell between 10 k and 25 k are usually sufficient. For in depth transcriptome anaylsis between 100k - 500k reads per cell are adequate. Please note that these are just general remarks and library complexity may differ considerably depending on cell type, state and quality of the input.
| A | B | C | |
| Number of cells | Mio. reads shallow seq. (25k per Cell) | Mio. reads deep seq. (500k per Cell) | |
| 96 | 2.4 | 48 | |
| 384 | 9.6 | 192 | |
| 1536 | 38.4 | 768 |
Exemplary sequencing depth calculations.
Appendix: Prepare Clean Up Beads (SPRI 22% PEG)
Prepare PEG Solution (22%) by adding all ingredients to a 50 mL falcon tube
| Reagent | Amount | |
| PEG 8000 | 11 g | |
| NaCl (5M) | 10 mL | |
| Tris-HCl (1M, pH 8.0) | 500 μL | |
| EDTA (0.5M) | 100 μL | |
| IGEPAL (10% solution) | 50 μL | |
| Sodium Azide (10% solution) | 250 μL | |
| UltraPure Water | up to 49 mL | |
| Total | 49 mL |
Bead Binding Buffer
Note
Do not add the total amount of water until after PEG is completely solubilized
Incubate at 40 °C and vortex regularly until PEG is completely dissolved
Resuspend Sera-Mag Speed Beads carefully and pipette 1000 µL of bead suspension into a 1.5 mL tube
Place on magnet stand and remove storage buffer
Add 1000 µL of TE Buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA) and resuspend beads
Place on magnet stand and remove supernatant
Repeat wash step one more time
Add 900 µL TE Buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA) and resuspend beads
Add the washed Sera-Mag Speed Beads to the PEG Solution (22%) and mix well
Note
The final Cleanup Beads can be aliquoted and stored at 4 °C for up to six months
Appendix: Prepare Pooling Beads (SPRI 22% PEG 5 times less Beads)
Prepare PEG Solution (22%) by adding all ingredients to a 50 mL falcon tube
| Reagent | Amount | |
| PEG 8000 | 11 g | |
| NaCl (5M) | 10 mL | |
| Tris-HCl (1M, pH 8.0) | 500 μL | |
| EDTA (0.5M) | 100 μL | |
| IGEPAL (10% solution) | 50 μL | |
| Sodium Azide (10% solution) | 250 μL | |
| UltraPure Water | up to 49 mL | |
| Total | 49 mL |
Note
Do not add the total amount of water until after PEG is completely solubilized
Incubate at 40 °C and vortex regularly until PEG is completely dissolved
Resuspend Sera-Mag Speed Beads carefully and pipette 200 µL of bead suspension into a 1.5 mL tube
Place on magnet stand and remove storage buffer
Add 1000 µL of TE Buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA) and resuspend beads
Place on magnet stand and remove supernatant
Repeat wash step one more time
Add 900 µL TE Buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA) and resuspend beads
Appendix: Prepare Pooling Beads (SPRI 22% PEG 5 times less Beads)
Add the washed Sera-Mag Speed Beads to the PEG Solution (22%) and mix well
Note
The final Cleanup Beads can be aliquoted and stored at 4 °C for up to six months