Protocol Citation: Rebekka Uhl 2023. MBA DTOL - DNA extraction and barcoding of Marine Metazoans . protocols.io https://dx.doi.org/
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: November 16, 2023
Last Modified: November 16, 2023
Protocol Integer ID: 91026
Keywords: barcoding of marine metazoan, marine biological association for dna extraction, marine metazoan, dna extraction, marine biological association, selection of organism, darwin tree of life project, darwin tree of life, darwin tree, species, barcoding method, organism, extraction, dna, more organism, due to these species
Funders Acknowledgements:
Wellcome Sanger Trust
Abstract
This document provides a guide to the protocols used by the Marine Biological Association for DNA extraction and barcoding of marine metazoans sampled for the Darwin Tree of Life project. The selection of organisms described are due to these species requiring more optimized techniques than the high-throughput method otherwise used by the Natural History Museum (dx.doi.org/10.17504/protocols.io.8epv5x7qjg1b/v1). Please note that this is a working document, with more organism-specific barcoding methods being added as they become optimized. The methods described are generally successful for the selected groups, but may still require further optimization for some samples.
DNA extraction: General
DNA extraction:
Unless otherwise stated, DNA extraction for marine metazoans is done with the Qiagen DNAeasy Mouse Blood and Tissue kit.
The provided protocol is followed, apart from the final elution step:
Pre-heated elution buffer (56C) is used to increase yield.
An elution volume of 60ul is used to increase the final DNA concentration.
The buffer is left to incubate on the membrane for 5 minutes.
If sample yields are relatively high (>25ng/ul), gDNA samples are usually diluted by 1:10 to reduce contamination during PCR amplification.
DNA Barcoding: Ascidians
Reference: Adapted from Salonna et al., 2021
Salonna, M., Gasparini, F., Huchon, D., Montesanto, F., Haddas-Sasson, M., Ekins, M., McNamara, M., Mastrototaro, F. and Gissi, C., 2021. An elongated COI fragment to discriminate botryllid species and as an improved ascidian DNA barcode. Scientific reports, 11(1), p.4078.
If unsuccessful, try repeating PCR with x35 cycles instead (generally required)
DNA barcoding: Fish
Reference: Adapted from Moran et al., 2016
Moran, Z., Orth, D.J., Schmitt, J.D., Hallerman, E.M. and Aguilar, R., 2016. Effectiveness of DNA barcoding for identifying piscine prey items in stomach contents of piscivorous catfishes. Environmental Biology of Fishes, 99, pp.161-167.
References: Adapted from Beckman et al., 2023 and Cunningham & Buss, 1993
Beckmann, L.M., Soto-Angel, J.J., Hosia, A. and Martell, L., 2023. Odd family reunion: DNA barcoding reveals unexpected relationship between three hydrozoan species. PeerJ, 11, p.e15118.
Cunningham, C.W. and Buss, L.W., 1993. Molecular evidence for multiple episodes of paedomorphosis in the family Hydractiniidae. Biochemical Systematics and Ecology, 21(1), pp.57-69.
DNA extraction:
Left in heat block for 1.5hrs (exoskeleton remains in tube – does not mean DNA is not extracted!)
Relatively varied DNA concentrations - usually required 1:10 dilution (if >10ng/ul) to reduce contamination.
Primers: 16s barcode
A
B
C
F
SHA
ACGGAATGAACTCAAATCATGT
R
SHB
TCGACTGTTTACCAAAAACATA
PCR reaction mix:
Mastermix
1x
RedTaq with MgCl2
25ul
Primer (10uM)
1ul
Mol. H2O
22ul
DNA template
1ul (usually 1:10 dil. of
extracts)
Total
50ul
Thermocycling conditions:
94C,5mins, 35x[94C, 30s; 50C, 30s; 72C, 1mins], 72C, 7 mins
If failed, increase reaction above to x39 cycles (some may better with x35 some better with x39 due to extent of contaminants)
DNA barcoding: Barnacles*
*Note: This method has been optimized for barnacle barcoding, but may also be useful for other crustaceans as universal COI primers are used (this has not been trialled).
Reference: Adapted from Benny et al., 2007
Chan, B.K., Tsang, L.M. and Chu, K.H., 2007. Morphological and genetic differentiation of the acorn barnacle Tetraclita squamosa (Crustacea, Cirripedia) in East Asia and description of a new species of Tetraclita. Zoologica Scripta, 36(1), pp.79-91.
Primer: COI barcodes
A
B
C
F
LCO1409
GGTCAACAAATCATAAAGATATTGG
R
HCO2198
TAAACTTCAGGGTGACCAAAAAATCA
PCR reaction mix:
Mastermix
1x
GoTaq 5x buffer
10ul
MgCl2 (25mM)
4ul
dNTPs (10uM each)
1ul
Primer (10uM)
1ul (each)
Mol. H2O
31.7ul
Taq
0.3ul
DNA template
1ul
Total
50ul
Thermocycling conditions:
94C,3mins, 33x[94C, 30s; 47C, 30s; 72C, 40s], 72C, 3 mins
DNA barcoding: Copepods
References: Adapted from Figueroa et al, 2020 and Rossel et al., 2023
Figueroa, N.J., Figueroa, D.F. and Hicks, D., 2020. Phylogeography of Acartia tonsa Dana, 1849 (Calanoida: Copepoda) and phylogenetic reconstruction of the genus Acartia Dana, 1846. Marine Biodiversity, 50, pp.1-20.
Rossel, S., Kaiser, P., Bode‐Dalby, M., Renz, J., Laakmann, S., Auel, H., Hagen, W., Arbizu, P.M. and Peters, J., 2023. Proteomic fingerprinting enables quantitative biodiversity assessments of species and ontogenetic stages in Calanus congeners (Copepoda, Crustacea) from the Arctic Ocean. Molecular Ecology Resources, 23(2), pp.382-395.
DNA extraction:
Samples were incubated in 30 μl chelex (InstaGene Matrix, Bio-Rad) for 50 min at 56°C, followed by a denaturation of the enzymes for 10 min at 96°C. Centrifuge samples @10,000rpm for 1min and carefully pipette out supernatant (avoid Chelex beads!). The resulting sample was used directly as DNA template for PCR amplification.