Apr 14, 2026

Manual DNA Extraction Protocol for Campylobacter Detection in Canine and Bovine Feces

  • 1Texas A&M University;
  • 2Ohio Animal Disease Diagnostic Laboratory
  • Vet LIRN
Icon indicating open access to content
QR code linking to this content
Protocol CitationSara D. Lawhon, Ching-Yuan Yang, Jing Wu, Melanie Prarat 2026. Manual DNA Extraction Protocol for Campylobacter Detection in Canine and Bovine Feces . protocols.io https://dx.doi.org/10.17504/protocols.io.36wgq7b6kvk5/v1
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: May 11, 2022
Last Modified: April 14, 2026
Protocol  Integer ID: 62442
Keywords: manual dna extraction protocol for campylobacter detection, campylobacter detection, campylobacter jejuni, detection in fecal sample, campylobacter, fecal sample, bovine fece, dna extraction protocol, manual dna extraction protocol, standard methods for the detection, foodborne illness, standard method for the detection, dna extraction, cause of foodborne illness, fece, human infection, veterinary patient, extraction
Funders Acknowledgements:
U.S. Food & Drug Administration Veterinary Laboratory Investigation and Response Network
Grant ID: U18FD005013
U.S. Food & Drug Administration Veterinary Laboratory Investigation and Response Network
Grant ID: U18FD006446
U.S. Food & Drug Administration Veterinary Laboratory Investigation and Response Network
Grant ID: U18FD006664
U.S. Food & Drug Administration Veterinary Laboratory Investigation and Response Network
Grant ID: U18FD007242
Disclaimer
Reference to any commercial materials, equipment, or process does not in any way constitute approval, endorsement, or recommendation by the Food and Drug Administration.
The authors thank the members of the U.S. Food & Drug Administration Veterinary Laboratory Investigation and Response Network who reviewed and tested the method during multiple interlaboratory comparison exercises and blinded method tests.
Abstract
Campylobacter jejuni is a leading cause of foodborne illness in people. Animals serve as a reservoir for human infection. While standard methods for the detection of C. jejuni in food products are readily available, there is considerable variation in methods published for detection in fecal samples from animals. This method was developed to provide a standard method for the detection of C. jejuni in feces from veterinary patients.

Validation data (in-house and by an independent laboratory via collaborative study such as Randomized Blinded Method Test) are available upon request.
Guidelines
All manufacturers' intended use, safety information, storage guidelines, and recommendations should be followed.

Campylobacter jejuni is infectious to humans and is a biological safety level 2 organism. All work with specimens that potentially contain C. jejuni should follow the best practices outlined in the most current version of Biosafety in Microbiological and Biomedical Laboratories (BMBL) and institutional guidance.

Reporting of positive test results should follow all local, state, and federal regulations.
Materials
QIAamp® PowerFecal® Pro DNA Isolation Kit (Qiagen, Inc. cat#51804-50)
VetMAX™ Xeno™Internal Positive Control DNA (ThermoFisher cat#s A29762/A29764)
VetMAX™ Xeno™ Internal Positive Control - VIC™ Assay (ThermoFisher Scientific A29765 or A29767)
TaqMan Fast Virus 1-step Master Mix (ThermoFisher Cat. Nos. 4444432/4444434/4444436)
Positive control DNA from C. jejuni ATCC 33291, ATCC 33292, or ATCC 33560
Negative control DNA from E. coli ATCC 25922
1X PBS (Life Technologies cat#10010-023)

From any manufacturer:
Microcentrifuge tubes - 1.5 mL, sterile
50 mL conical tubes - sterile
Pipette tips - 1 mL
Pipette tips - 200 µL
Serological pipette, 25 mL

AB
Oligo Name 5’-3’ Sequence
gyrA-F AAGATACGGTCGATTTTGTTCCA
gyrA-R CTACAGCTATACCACTTGAACCATTTAATA
gyrA-P 5’-[FAM]TGATGGTTCAGAAAGCGAACCTGATGTTTT[BHQ1]-3’
Primers and probe for Campylobacter jejuni PCR
Primers and probe are diluted to a working concentration of 10 µM with a final concentration in the total reaction volume of 0.5 µM.

Equipment needed:
Scale for weighing 8 g of feces
Pipettes for appropriate volumes
Centrifuge for microcentrifuge tubes capable of speeds of up to 16,000 Χ g
Vortexer for the fecal slurry
Vortexer with Qiagen (MoBio) Vortex Adapter (Cat#13000-V1-24)

Reference for primers and probe
Iijima Y, Asako NT, Aihara M, Hayashi K. (2004) Improvement in the detection rate of diarrhoeagenic bacteria in human stool specimens by a rapid real-time PCR assay. J Med Microbiol. 2004 Jul;53(Pt 7):617-22. PMID: 15184531
Protocol materials
1X PBSLife TechnologiesCatalog #10010-023
VetMAX Xeno Internal Positive Control NDThermo Fisher ScientificCatalog #A29762/A29764
QIAamp PowerFecal Pro DNA Isolation KitQiagenCatalog #51804-50
Safety warnings
All manufacturers' intended use, safety information, storage guidelines, and recommendations should be followed.

Appropriate safety and personal protective equipment should be worn while working with chemicals including a suitable lab coat, disposable gloves, and protective eyewear.

Campylobacter jejuni is infectious to humans and is a biological safety level 2 organism. Work with specimens that may contain this organism should follow all applicable institutional guidelines.
Background
Fecal samples should be stored at 4-8 °C refrigerated until processed.

Samples should be processed within 72 hours of receipt at the laboratory.
Plates and enrichment broth should be incubated in a microaerophilic environment at 42 °C + or - 2 .

Remaining samples from the associated culture method can be used for molecular detection.
This protocol uses VetMAX Xeno Internal Positive Control NDThermo Fisher ScientificCatalog #A29762/A29764 as a control for PCR inhibition.
Note
Note: This reagent can either be added at step 15 to serve as a DNA extraction control or after DNA extraction is complete to serve as the PCR inhibition control. If the laboratory has a system in place for DNA extraction and PCR inhibition, that method can be substituted in this protocol.


Sample Preparation
5m
Use 8 g of stool in 50 mL conical tubes



Add 32 mL 1X PBSLife TechnologiesCatalog #10010-023 to 8 g of feces. The feces in PBS will hereafter be called the feces-PBS slurry.
Making the Feces-PBS slurry.

Allow samples to sit for 00:02:00 after adding the 32 mL PBS

2m
Vortex samples for 00:00:30 to prepare fecal slurry

30s
PCR Method - DNA Extraction
19m 10s
Extract DNA from the feces using the QIAamp PowerFecal Pro DNA Isolation KitQiagenCatalog #51804-50 following the manufacturer's protocol (outlined below).

Note
Tip: If you are following the manufacturer’s printed protocol, whenever the text says “vortex briefly” vortex for at least 5-10 seconds.



Check solution CD3. If solution CD3 has precipitated, heat solution to 60 °C in a water bath until precipitate has dissolved.

To a microcentrifuge tube, add 1 mL of feces-PBS slurry from Sample Preparation step 7.
Pipetting the Feces-PBS slurry to a microcentrifuge tube.

Centrifuge at 15000 x g, Room temperature, 00:01:00


1m
Remove and carefully discard 800 µL of the supernatant without disturbing the pellet.
Removing 800 uL of the supernatant.

Add 800 µL Solution CD1 (Qiagen), and add 4 µL VetMAX Xeno Internal Positive Control, and resuspend the fecal pellet.
VetMAX Xeno Internal Positive Control NDThermo Fisher ScientificCatalog #A29762/A29764

Transfer the fecal pellet that is resuspended in CD1 to a bead tube.
Bead tube from the manufacturer.

Secure the bead tubes horizontally on a
Equipment
Vortex Adapter
NAME
Tube holder
TYPE
Qiagen (MoBio)
BRAND
13000-V1-24
SKU
Vortexer with Qiagen (MoBio) vortex adapter.
or secure the tubes on a flat-bed vortex pad with tape.

Vortex at maximum speed for 00:10:00 10 min.

Note
Tip: If vortexing more than 12 tubes, add an additional 5 min.


10m
Centrifuge at 15000 x g, Room temperature, 00:01:00


1m
Transfer 500-600 µL of the supernatant to a clean 2mL Microcentrifuge Tube.

Note
Note: Expect 500-600 µl of supernatant. The supernatant may still contain some stool particles.

Add 200 µL of CD2 and vortex for 00:00:05 .

5s
Centrifuge at 15000 x g, Room temperature, 00:01:00

1m
Avoiding the pellet, transfer up to 700 µL of supernatant to a clean 2 ml Microcentrifuge Tube

Note
Note: Expect 500-600 µl of supernatant.

Add 600 µL of Solution CD3 and vortex for 00:00:05

5s
Load 650 µL of lysate onto a MB Spin Column.
Spin Column

Centrifuge at 15000 x g, Room temperature, 00:01:00


1m
Discard the flow-through, place the MB Spin Column back into the same 2ml Collection Tube and repeat steps 24 and 25 to ensure that all of the supernatant has been loaded onto the MB Spin Column.
Carefully place the MB Spin Column into a clean 2ml Collection Tube. Avoid splashing any flow-through onto the MB Spin Column.
Add 500 µL of Solution EA to the MB Spin Column.

Centrifuge at 15000 x g, 00:01:00
1m
Discard the flow through and place the MB Spin Column back into the same 2 ml Collection Tube.
Add 500 µL of Solution C5.

Centrifuge at 15000 x g, 00:01:00
1m
Discard the flow through and place the MB Spin Column in a clean 2 ml Collection Tube.
Centrifuge at 16000 x g, Room temperature, 00:02:00

2m
Carefully place the MB Spin Column into a new 1.5 ml Elution Tube
Add 60 µL of Solution C6 to the center of filter membrane

Centrifuge at 15000 x g, Room temperature, 00:01:00

1m
Discard the MB Spin Column. The DNA is now ready for PCR.

Note
If PCR will be performed within 1-5 days store the DNA at 4 °C . If PCR will be performed after 5 days post DNA isolation, store the DNA at -20 °C until ready to run PCR


PCR Method - Setting up and running the PCR reactions
The probe is labeled with FAM with Black Hole Quencher 1 (BHQ1) so detection parameters appropriate for FAM or SYBR should be used.The developing laboratory uses Applied Biosystems™ VetMAX™ Xeno™ Internal Positive Control DNA (ThermoFisher Scientific A29762 or A29764) and the VetMAX™ Xeno™ Internal Positive Control - VIC™ Assay (ThermoFisher Scientific A29765 or A29767) to monitor for PCR inhibition.

Note
Threshold is set at 0.2.

Create run on ABI 7500 Fast machine. Setting up the ABI 7500 Fast Thermocycler: Refer to the manual provided for running the machine. Reaction times are as follows in Table 1.
Equipment
7500 Fast Real-Time PCR System, desktop
NAME
Applied Biosystems
BRAND
4351107
SKU

ABCDEF
StageFunctionTemperatureDuration (sec)RepeatsOptics
Reverse Transcription50°C300
Stage 1Initial PCR Activation95.0°C20Off
Stage 2Annealing95.0°C3Repeats 45 timesOff
Stage 2Extension60°C60On
Table 1a. PCR amplification conditions in ABI 7500 under standard conditions are as follows:

ABCDEF
StageFunctionTemperatureDuration (sec)RepeatsOptics
Reverse Transcription50°C300
Stage 1Initial PCR Activation95.0°C20Off
Stage 2Annealing95.0°C3Repeats 45 timesOff
Stage 2Extension60°C60On
Table 1b. PCR amplification conditions in ABI 7500 under FAST conditions are as follows:

Note
Passive reference dye should be set as ROX

Calculate the number of PCR reactions to be performed. Using Table 2 as a guide, determine the quantity of each reagent needed. Include a positive (C. jejuni ATCC 33291, ATCC 33292, or ATCC 33560) and negative (E. coliATCC 25922) control and a “No Template” negative control.

For calculations, reference Table 2. PCR Worksheet for Reagent Volumes for Master Mix Preparation for Campylobacter jejuni PCR.

Download Table2 PCR Worksheet Campy Manual Extraction.xlsxTable2 PCR Worksheet Campy Manual Extraction.xlsx

Combine reagents except for the DNA template in a 1.5ml or 2ml microcentrifuge tube and mix well.
Aliquot 18 µL into each PCR tube or reaction well if using a plate.

Add samples and positive (C. jejuni ATCC 33291, ATCC 33292, or ATCC 33560 DNA) and negative (E. coli ATCC 25922 DNA) controls along with PCR inhibition controls VetMAX Xeno Internal Positive Control NDThermo Fisher ScientificCatalog #A29762/A29764 ;Lot_________________).

Place Samples in thermocycler and perform run.
Following run, analyze the results. Results should be reported with a Ct value and interpretation.
Samples with a Ct value of 40 or less should be interpreted as positive. Samples with a Ct value >40 or an undetermined Ct value should be considered negative.



ABC
TargetCT ValueInterpretation
gyrA<=40Detected
>40Not detected
Table 3.Interpretation of Ct Value


AB
Oligo Name5’-3’ Sequence
gyrA-FAAGATACGGTCGATTTTGTTCCA
gyrA-RCTACAGCTATACCACTTGAACCATTTAATA
gyrA-P5’-[FAM]TGATGGTTCAGAAAGCGAACCTGATGTTTT[BHQ1] 3’
Table 4. Primers and Probe