Oct 25, 2023

LRRK2 cloning, plasmid construction, and mutagenesis

  • David Snead1,2,
  • Yu Xuan Lin1,2
  • 1Department of Cellular and Molecular Medicine, University of California, San Diego, La Jolla, CA 92093;
  • 2Aligning Science Across Parkinson’s (ASAP) Collaborative Research Network, Chevy Chase, MD, 20815, USA
Icon indicating open access to content
QR code linking to this content
Protocol CitationDavid Snead, Yu Xuan Lin 2023. LRRK2 cloning, plasmid construction, and mutagenesis. protocols.io https://dx.doi.org/10.17504/protocols.io.kxygx35ddg8j/v1
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: October 23, 2023
Last Modified: October 25, 2023
Protocol  Integer ID: 89780
Keywords: mutagenesis of lrrk2, lrrk2 cloning, protocol for cloning, mutagenesi, cloning, lrrk2, plasmid construction, rckw
Funders Acknowledgements:
ASAP
Grant ID: ASAP-000519
MJFF
Grant ID: 18321
Abstract
Protocol for Cloning, plasmid construction, and mutagenesis of LRRK2 and LRRK2-RCKW as done by Leschziner and Reck-Peterson Labs.
Original protocol by David Snead and Yu Xuan Lin.
Materials
Materials
  • Q5 Site-Directed Mutagenesis (NEB)
  • DH5α competent cells.
  • QIAprep Spin Miniprep Kit (Qiagen)

Equipment
  • Thermocycler

Cloning, plasmid construction, and mutagenesis
The DNA coding for LRRK2-RCKW residues 1327 to 2527 (taken from Mammalian Gene Collection) was PCR-amplified using the forward primer TACTTCCAATCCATGAAAA491AGGCTGTGCCTTATAACCGA and the reverse primer TATCCACCTTTACTGTCACTCAACAGATGTTCGTCTCATTTTTTCA.
The DNA coding for LRRK2 was codon-optimized for Spodoptera frugipera (Sf9) cells and synthesized by Epoch Life Science.
The DNA for either LRRK2 and LRRK2-RCKW, containing a N-terminal His6-Z-tag and TEV protease cleavage site, was cloned into a pFB-6HZB vector (SGC) by ligation-independent cloning, RRID:Addgene_53641
LRRK2 variants were generated using Q5 Site-Directed Mutagenesis Kit (NEB).
Primers for G2019S mutant:
Forward: gccaagatcgctgactacagcattgcccagtactgttgc
Reversed: gcaacagtactgggcaatgctgtagtcagcgatcttggc

Primers for I2020T mutant:
Forward: ccaagatcgctgactacggaactgcccagtact
Reversed: agtactgggcagttccgtagtcagcgatcttgg

Using the following thermocycler conditions.
98 °C 00:00:30
( 98 °C 00:00:10
50-72 °C 00:00:30
72 °C 00:13:00
72 °C 00:02:00 ) X25 cycles
4 °C Hold.
PCR products were subject to a KLD reaction (NEB), followed by a transformation into DH5α competent cells and plated on LB with antibiotics.
Colonies were picked and grown overnight for DNA extraction using Qiagen miniprep kit.
Extracted DNA plasmids were submitted for sequencing.
The resulting plasmids were utilized for the generation of recombinant Baculoviruses according to the Bac-to-Bac expression system protocol (Invitrogen).