Oct 22, 2020
Low Volume Methodology for Nextera DNA Flex Library Prep Kit (96 Samples)
- Eric Adams1,
- Stephen Wandro1,
- Julio Avelar-Barragan1,
- Andrew Oliver1,
- Katrine Whiteson1
- 1Department of Molecular Biology and Biochemistry, University of California, Irvine, Irvine, CA, United States
Protocol Citation: Eric Adams, Stephen Wandro, Julio Avelar-Barragan, Andrew Oliver, Katrine Whiteson 2020. Low Volume Methodology for Nextera DNA Flex Library Prep Kit (96 Samples). protocols.io https://dx.doi.org/10.17504/protocols.io.be6rjhd6
Manuscript citation:
Adams, E. et al. Comparing Fecal, Saliva, and Chicha Microbiomes Between Mothers and Children in an Indigenous Ecuadorian Cohort. bioRxiv 2020.10.02.323097 (2020) doi:10.1101/2020.10.02.323097.
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it works for us in our lab.
Created: April 16, 2020
Last Modified: October 22, 2020
Protocol Integer ID: 35761
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK
The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
This protocol presents a low volume methodology for the Nextera DNA Flex Library Prep Kit (96 Samples). This method increases the number of sequencing libraries which can be generated using each kit from 384 samples (4 x 96-wells) to 864 samples (9 x 96-wells). While other low-cost methods have been deveolped for this purpose, this protocol is a very straightforward method utilizing reduced reagent and sample volumes.
Update: The "Nextera DNA Flex Library Prep" kit has been renamed to "Illumina DNA Prep" with the appropriate indexes having been similarly renamed. While all reagents and steps remain identical, an updated version of this protocol may be published to account for any differences between the protocols.
Guidelines
Primers used with the Kapa HiFi ReadyMix:
KAPA-PCR-F: AATGATACGGCGACCACCG*A
KAPA-PCR-R: CAAGCAGAAGACGGCATACG*A
Order these from IDT at 1umole scale with HPLC purification.
The * is a phosphothioate bond that prevents polymerases with 3’-5’ proof-reading activity from chewing back the oligos
Materials
MATERIALS
Proteinase K
Nuclease-free Water
Kapa HiFi Hotstart ReadyMix (2x)Kapa BiosystemsCatalog #KK2612
Fresh 80% Ethanol
Magnetic Stand-96ThermofisherCatalog #AM10027
Sterile reagent reservoirs
Nextera DNA Flex Library PrepIllumina, Inc.Catalog #20018705
Adhesive PCR Plate FoilsThermo FisherCatalog #AB0626
0.2mL PCR Tube Strips, 8-Tube Strip; 120/Pk.Thermo FisherCatalog #E0030124286
96-well PCR plates
IDT for Illumina Nextera DNA Unique Dual IndexesIllumina, Inc.Catalog #20027213
Before start
1. Enter and save the TAGflex tagmentation protocol on the thermal cyclers:
a. Enable the heated lid (to 100°C if the option is available)
b. 55°C for 15m followed by a hold at 10°C
2. Enter and save the TAGstop tagmentation stop protocol on the thermal cyclers:
a. Enable the heated lid (to 100°C if the option is available)
b. 37°C for 15m followed by a hold at 10°C
3. Enter and save the flexPCR protocol on the thermal cyclers:
a. 72°C for 3m
b. 98°C for 3m
c. 12 cycles of:
i. 98°C for 45s
ii. 62°C for 30s
iii. 72°C for 2m
d. 72°C for 1m
e. 4°C hold
4. Enter and save the protK protocol on the thermal cyclers:
a. 37°C for 30m
b. 68°C for 10m
c. 4°C hold
Preparation
Preparation
Equilibrate the following reagents at Room temperature for 00:30:00
Bead-Linked Transposomes (BLT)
Tagmentation Buffer (TB1)
Tagment Stop Buffer (TSB)
Tagment Wash Buffer (TWB)
Sample Purification Beads (SPB)
Thaw the Resuspension Buffer (RSB) and bring to Room temperature then vortex to mix
Prepare a proteinase K solution at 300 μg/mL
Note
For a 1mL solution: add 15μL of 20mg/mL proteinase K to 985μL of nuclease-free water
Thaw KAPA HiFi HotStart ReadyMix (2X) On ice
Thaw the i5 and i7 indexes at Room temperature
Note
Index tubes: vortex and spin down briefly
Index plates: spin down at 1500 rpm to ensure no droplets remain on the plate cover
Index stocks should be diluted to 10 micromolar (µM) working stocks
Prepare a Tagmentation Master Mix (TMM)
TMM contains 1μL BLT and 1μL TB1 per reaction
Vortex BLT vigorously before use and ensure the beads are evenly resuspended
Make a 110X mix: 110 µL TB1 + 110 µL BLT
Vortex to mix
Prepare PCR Master Mix (PCR MM) On ice
PMM contains 2.75μL nuclease-free water, 0.5μL KAPA-PCR-F primer, 0.5μL KAPA-PCR-R primer, and 6.25μL KAPA HiFi HotStart ReadyMix (2X) per reaction
Note
See Guidelines section for KAPA primer design
KAPA primer stocks should be diluted to 10 micromolar (µM)
Make a 110X mix: 302.5 µL nuclease-free water + 55 µL KAPA-PCR-F + 55 µL KAPA-PCR-R + 687.5 µL KAPA HiFi HotStart ReadyMix (2X)
Vortex to mix and briefly spin down
Prepare a diluted SPB Master Mix (SPB MM)
54 µL SPB + 48 µL nuclease-free water
96-Well Tagmentation
96-Well Tagmentation
Transfer at least 100 ng genomic DNA (up to 500ng) into each well of a 96-well PCR plate in 1-5μL
Adjust the volume of each well to 5 µL total volume using nuclease-free water
Load 27 µL TMM into each tube of an 8-strip of PCR tubes
Vortex TMM thoroughly before use and ensure the beads remain evenly suspended while being aliquoted into the 96-well plate
Add 2 µL TMM to each well using an 8-channel pipette
Thoroughly mix by gentle pipetting
Note
If beads are adhered to the top or side of the 96-well plate, briefly centrifuge and fully resuspend the bead pellet by pipetting until thoroughly mixed
Seal the plate with a PCR plate cover, place in a thermal cycler, and run the TAGflex program
Note
It is especially important to be able to remove the plate seal as easily as possible to prevent cross contamination
Proceed immediately to the next steps upon completion of the TAGflex cycle
Post Tagmentation Cleanup
Post Tagmentation Cleanup
Load 15 µL TSB per tube in an 8-strip of PCR tubes
Gently remove the plate seal and add 1 µL TSB into each tagmentation reaction using an 8-channel pipette
Mix by gently pipetting the entire volume, ensuring the beads are fully resuspend
Seal the plate, place in a thermal cycler, and run the TAGstop program
Remove the seal and place the plate on a 96-well magnetic plate stand for 00:03:00 or until solution is clear
Carefully remove the supernatant using an 8-channel pipette without disturbing the beads
Load 6 mL TWB into a sterile trough to pipette from
Remove the plate from the magnetic stand and add 20 µL TWB to each well using an 8-channel pipette
Mix by gently pipetting (slowly, to minimize foaming) until beads are fully resuspended
Place the plate on the magnetic stand for 00:03:00 or until solution is clear
Carefully remove the supernatant using an 8-channel pipette without disturbing the beads
Repeat steps 20-22 one more time for a total of 2 washes
Remove the plate from the magnetic stand and add 20 µL TWB to each well
Gently pipette until beads are fully resuspended
Seal the plate and place on the magnetic stand to incubate until needed in the next section
Note
Keeping the pellet in TWB helps prevent over-drying of the beads
Amplify Tagmented DNA
Amplify Tagmented DNA
Load 135 µL PCR MM per tube into an 8-strip of PCR tubes (store On ice until needed)
Carefully remove the TWB supernatant from the samples while on the magnetic stand
Note
Any remaining foam on the well walls should not adversely affect the library
Remove the plate from the magnetic stand and proceed immediately to the next step to prevent excessive drying of the beads
Add 10 µL PCR MM to each sample and pipette the mix to ensure the beads are thoroughly resuspended
Note
Pipette with moderate force as the beads can be difficult to fully resuspend
Seal the plate and spin down briefly up to 1000 rpm
Add 2.5 µL of an equimolar mix of each i7 and i5 index combination to their respective wells
Note
Individual index tubes: 1.25μL i7 index (N7xx) + 1.25μL i5 index (N5xx)
Pre-mixed index plate: Transfer 2.5μL of each index combination using an 8-channel pipette
Pipette to mix a minimum of 10 times, then seal the plate and breifly spin up to 1000 rpm
Place the plate in a thermal cycler and run the flexPCR program
Remove the plate from the thermal cycler and spin down for 00:01:00 at 280 x g
Load 35 µL of 300 μg/mL proteinase K per tube into an 8-strip of PCR tubes
Remove the plate seal and add 2.5 µL proteinase K to each PCR reaction using an 8-channel pipette
Mix the wells by pipetting a 10uL volume at least ten times
Seal the plate, place in a thermal cycler, and run the protK program
If stopping, keep the plate sealed and store at 4°C for up to 3 days
Otherwise, continue with the next section
Post-PCR Library Clean Up
Post-PCR Library Clean Up
Remove the seal and place the plate on the magnetic stand for 00:05:00 or until the supernatant is clear
Using an 8-channel pipette, transfer 2 µL PCR supernatant from each well into an 8-strip of PCR tubes
From the 8-strip of PCR tubes, transfer all samples to a single 1.5mL Eppendorf tube
Note
Each tube in the strip should contain ~24μL of pooled sample, yielding ~192μL of pooled libraries
Vortex and briefly spin down to mix the pooled libraries evenly
Transfer a 45 µL aliquot of the pooled libraries to a new 1.5mL Eppendorf tube
Vortex and invert SPB MM multiple times to ensure full resuspension
Add 85 µL SPB MM to the pooled library aliquot
Pipette until thoroughly mixed
Note
Complete mixing is critical to proper size distribution of libraries
Incubate at Room temperature for 00:05:00
Place the Eppendorf tube on a magnetic stand for 00:05:00 or until the supernatant is clear
Transfer 120 µL supernatant into a new 1.5mL tube without disturbing the beads
Vortex and invert the SPB (undiluted stock) until thoroughly resuspended
Add 14.4 µL SPB (undiluted stock) to the new 1.5mL tube containing the supernatant
Pipette a 120μL volume until thoroughly mixed
Incubate at Room temperature for 00:05:00
Place the Eppendorf tube on a magnetic stand for 00:05:00 or until clear
Remove and discard the supernatant without disturbing the beads
With the tube on the magnetic stand, add 200 µL 80% ethanol without mixing and incubate for 30s
Note
Add enough 80% ethanol so that the beads are entirely submerged
Pipette to remove the ethanol without disturbing the beads
Repeat steps 55-56 one more time for a total of 2 washes
Remove any excess liquid from the tube using a pipette without disturbing the beads
Air-dry beads on the magnetic stand for 00:05:00
Warm 35 µL RSB at 50 °C to increase final library yield
Remove the 1.5mL tube from the magnetic stand
Add 32 µL RSB (warm) to the beads
Pipette mix until thoroughly resuspended
Incubate on the bench at Room temperature for 00:02:00
Place the 1.5mL tube back on the magnetic stand for 00:02:00 or until clear
Transfer 30 µL supernatant into a new 1.5mL Eppendorf tube
Let the tube with the eluted library sit at 50 °C for 00:05:00 to ensure complete dissolution of the library
Quantify the library using a Qubit fluorometer
Determine fragment size distribution using a Bioanalyzer