Sep 29, 2025

Public workspaceLONP1 knockdown in iPSC-derived microglia

DOI
https://dx.doi.org/10.17504/protocols.io.36wgqpb5xvk5/v1
  • Maria Jose Perez J.1
  • 1Institut Imagine
  • Team Deleidi
Federico Bertoli
Icon indicating open access to content
QR code linking to this content
DOI: https://dx.doi.org/10.17504/protocols.io.36wgqpb5xvk5/v1
Protocol Citation: Maria Jose Perez J. 2025. LONP1 knockdown in iPSC-derived microglia. protocols.io https://dx.doi.org/10.17504/protocols.io.36wgqpb5xvk5/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: September 25, 2025
Last Modified: September 29, 2025
Protocol Integer ID: 228166
Keywords: microglia lonp1 knockdown in ipsc, derived microglia lonp1 knockdown
Funders Acknowledgements:
ASAP
Abstract
LONP1 knockdown in iPSC-derived microglia
Troubleshooting
Obtain shLONP1 plasmid (target sequence: CCAGTGTTTGAAGAAGACCAA; TRCN0000046793) from the MISSION‱ shRNA library (Sigma-Aldrich) and clone into the pLKO.1-puro vector backbone.
Obtain non-targeting control shRNA from VectorBuilder (VB010000-0005mme)
Produce lentiviral particles by transfecting HEK293T cells with shRNA plasmids together with the packaging plasmid psPAX2 (RRID:Addgene_12260) and the envelope plasmid pMD2.G (RRID:Addgene_12259)
Use TransIT-X2 (Mirus Bio) for transfection according to the manufacturer’s instructions
Quantify the concentration of p24 capsid protein using Lenti-X GoStix Plus (Takara Bio)
Normalize viral amounts to equal p24 levels
Add p24-normalized lentiviral particles directly to iPSC-derived microglial cultures without using transfection reagents
Analyze cells at 24, 48, and 72 hours after shRNA treatment