Feb 20, 2026

Public workspaceLong Term Nucleic Acids Storage Using Dried Stool Spots and qPCR Validation for Enteric Pathogens

This protocol is a draft, published without a DOI.
  • Erin Baumgartner1,
  • Audrey Safir1,
  • Wensheng Luo1,
  • Jie Liu2,
  • David Sack1,
  • Amanda Debes1
  • 1Department of International Health, Johns Hopkins Bloomberg School of Public Health;
  • 2School of Public Health, Qingdao University, Qingdao, China
Audrey Safir
Icon indicating open access to content
QR code linking to this content
Protocol Citation: Erin Baumgartner, Audrey Safir, Wensheng Luo, Jie Liu, David Sack, Amanda Debes 2026. Long Term Nucleic Acids Storage Using Dried Stool Spots and qPCR Validation for Enteric Pathogens. protocols.io https://protocols.io/view/long-term-nucleic-acids-storage-using-dried-stool-hjugb4ntx
Manuscript citation:
Debes, A.K., Baumgartner, E.T, Safir, A., Luo, W., Williams, C., Guenou, E., Houpt, E.R., Ateudjieu, J., Sack, D.A., Page, N., Liu, J., and Perin, J. Redefining Diarrheal Disease Surveillance: Long Term Nucleic Acids Stability with Simple, Low-Cost Stool Preservation. Available at SSRN: https://ssrn.com/abstract=5738404 or http://dx.doi.org/10.2139/ssrn.5738404
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: January 06, 2026
Last Modified: February 20, 2026
Protocol Integer ID: 237160
Keywords: qPCR, nucleic acid extraction, filter paper, stool sample preservation, diarrheal disease, enteric, norovirus sample, extracted whole stool sample, extraction of nucleic acid, validation for enteric pathogen, qpcr assay, stool spots on filter paper, rotavirus sample, using dried stool spot, long term nucleic acids storage, dried stool spot, whole stool sample, enteric pathogen, slight nucleic acid degradation, slight nucleic acid degradation upon initial spotting, filter paper for qpcr detection, extraction, norovirus, using boil extraction, nucleic acid stability over time, nucleic acid stability, qpcr detection, extracted sample, nucleic acid, stool spot, boil extraction, boil extraction method, term stool storage
Funders Acknowledgements:
Gates Foundation
Grant ID: INV-047706
Abstract
This protocol describes the extraction of nucleic acid from dried stool spots on Whatman903 filter paper for qPCR detection of enteric pathogens. The boil extraction method using Chelex-100 resin for filter paper is presented in conjunction with a protocol for column-extracted whole stool samples (current gold standard method), followed by a qPCR assay to evaluate nucleic acid stability over time for rotavirus, norovirus, and Shigella. Extrinsic controls MS2 and PhHV are used to evaluate extraction and amplification efficiency. An extraction blank is included to ensure samples are not contaminated.

Using this protocol, nucleic acid extracted from filter paper using boil extraction remained stable and comparable to column-extracted samples for up to 18 months for Shigella and rotavirus samples. Norovirus samples showed slight nucleic acid degradation upon initial spotting but remained stable for the rest of the 18-month study period, supporting the use of dried stool spots on filter paper as a practical alternative for long-term stool storage.
Materials
Spotting and Aliquoting:
1. Frozen whole stool samples
2. Tabletop vortex
3. P200 pipette
4. Cut 200uL pipette tips (use autoclaved surgical scissors to cut ~2mm off the tip)
5. Whatman 903 Protein Saver Filter Paper cards
6. Ice bucket
7. 1.5mL centrifuge tubes, labeled


Qiagen Nucleic Acid Extraction:
  1. QIAamp Fast Stool Mini Kit
  2. Extrinsic control mix (prepared in MS2/PhHV control mixing step)
  3. Prepared InhibitEX + Controls solution (see preliminary steps)
  4. 96%-100% Ethanol
  5. PCR-grade water
  6. Heating block (2 preferred, 1 minimum)
  7. Tabletop centrifuge
  8. Tabletop vortex
  9. Tube rack(s)
  10. Tube sealers
  11. Pipettes (P10, P20, P200, P1000)
  12. Pipette tips (10uL, 20uL, 200uL, 1000uL)
  13. Serological pipettes (10mL, 25mL)
  14. 15mL conical tube
  15. For each sample (+ blank): 2 x 2.0mL centrifuge tubes, 1 tube with spin column, 1 x 1.5mL centrifuge tube

Filter Paper Extraction:
  1. Heat block, set at 100C.
  2. Tabletop centrifuge
  3. Tabletop vortex
  4. Tube rack(s)
  5. Tube sealers
  6. Clean, autoclaved surgical scissors (1 per sample plus 2-3 extra)
  7. Pipettors (P10, P20, P200, P1000)
  8. Pipette tips (10uL,20uL, 200uL, 1000uL)
  9. 1X autoclaved PBS, prepared using PCR-grade water and 10x PBS stock (at least 2mL needed per sample)
  10. Prepared Chelex solution (see step 28)
  11. Extrinsic control mix (prepared in MS2/PhHV control mixing step)

Standard Curve Preparation:
1. HindIII linearized positive control (see "Linearizing Positive Control" section)
2. PCR-grade water
3. 96-well round bottom plate
4. Clean biosafety hood
5. Tabletop centrifuge
6. Tabletop vortex
7. Tube rack(s)
8. Pipettes (P10, P20, P100)
9. Pipette tips (10uL, 20uL, 200uL)

Plating Protocol:
  1. 2x AgPath Buffer
  2. PCR-grade water
  3. Target primer/probe mix
  4. Extrinsic control primer/probe mix
  5. Enzyme mix
  6. Extracted nucleic acid
  7. Prepared standard curve
  8. 96-well qPCR reaction plate
  9. qPCR plate clear adhesive film
  10. Plate roller/sealer
  11. PCR plate holder
  12. Tabletop centrifuge
  13. Tube rack
  14. Pipettors (P10, P20, P100, P200, P1000)
  15. Pipette tips (10uL, 20uL, 200uL, 1000uL)

qPCR Run Protocol:
1. Fully prepared qPCR plate, wrapped in foil and stored on ice until ready to run
2. QuantStudio or similar qPCR machine
3. Centrifuge with plate holder and balance

Extrinsic Control Mixing:
1. Lyophilized MS2/PhHV mix, kept at -80C until use. Reconstitute one vial at a time as needed
2. STD diluent, stored at -80C.
3. Tabletop centrifuge
4. Tabletop vortex
5. Tube rack(s)
6. Pipette (P200)
7. Pipette tips (200uL)

Linearizing Positive Control:
  1. 200uL PCR tubes with caps
  2. Pipettes (p2, p10, p100, p1000)
  3. Pipette tips (10uL, 20uL, 200uL, 1000uL)
  4. Tube rack
  5. Flat-bottom 96-well plate (to use as a holder for the PCR strip tubes)
  6. 1.5mL microcentrifuge tubes


Troubleshooting
Before start
Ensure that workspaces and equipment are thoroughly cleaned before performing any of these steps. Spray surfaces and pipettes with RNase/DNase Away and 70% ethanol before beginning. Spotting and extractions may be performed at the bench, however, standard curve preparation and plating should be done in a biosafety cabinet or PCR hood to avoid contamination. Ideally, nucleic acid should be extracted the same day as qPCR plating, especially for RNA viruses. DNA from bacterial pathogens may be extracted ahead of plating if necessary. If using previously extracted nucleic acid, allow the samples to thaw on ice before plating.
Spotting and Aliquoting
Thaw frozen stool samples into a prefilled ice container and cover with lid.

Once stool samples are half-thawed, you may vortex until homogenous.
Keep stool samples on ice for the duration of the protocol.
Using a P20 pipette and cut 20uL tips, pipette 20uL of stool into the center of each circle on the correspondingly labeled Whatman card. If the stool is not completely liquid, spread evenly within the circle using the pipet tip. Set aside at room temperature.
Repeat steps 1-3 for the remaining samples.
Let filter paper spots dry for 90 minutes.
If the gold standard (Qiagen Kit extraction) protocol is to be completed, aliquot 200uL of whole stool into 1.5mL prelabeled centrifuge tubes.
Place stool samples immediately back at -80C.
If storing, let spots completely dry overnight, and place in pre-labeled boxes and storage conditions.
If the specimen is to be used for T0 (day-of extraction), proceed to the extraction protocol after 90 minutes of drying.
Qiagen Nucleic Acid Extraction
Line a waste container with a plastic bag.
Aliquot 200uL of whole stool to labeled 2mL centrifuge tubes (tube 1) for sample processing. For the blank, aliquot 200uL of RNase-free water instead of stool.
This protocol is slightly modified from the manufacturer's instructions for the QIAamp Fast DNA Stool Mini Kit. Download QIAmp Fast DNA Stool Mini Kit.pdfQIAmp Fast DNA Stool Mini Kit.pdf501KB

Add 1mL InhibitEX to each prepared tube.
Add 1uL of extrinsic control (MS2/PhHV) to each tube and vortex until fully homogenized.
Place tube sealers on each tube and incubate at 95C for 5 minutes.
Centrifuge for 1 minute at 13,300 rpm.
Add 25uL Proteinase K to the labeled 2.0mL centrifuge tube without specimen (tube 2) for sample processing.
Transfer 600uL of lysate from tube 1 and place it in the corresponding 2.0mL tube 2 containing the Proteinase K. Discard the original 2.0mL tube containing the remaining lysate.
Add 600uL buffer AL to each sample tube and briefly vortex.
Incubate samples at 70C for 10 minutes.
Once incubation time has elapsed, add 600uL ethanol to each sample and vortex for 15 seconds.
Transfer 600uL of lysate to the spin column. Do not discard the tube containing the lysate. Centrifuge the spin columns for 1 minute at 13,300 rpm. Discard the used collection tube and transfer the spin column to a fresh collection tube.
Repeat step 12 until all lysate is put through the spin column.
Add 500uL buffer AW1 to the spin column and centrifuge for 1 minute at 13,300 rpm. Discard collection tube and transfer spin column to a fresh collection tube.
Add 500uL buffer AW2 to the spin column and centrifuge for 3 minutes at 13,300 rpm. Discard collection tube and transfer spin column to a fresh collection tube.
Centrifuge for an additional 3 minutes at 13,300 rpm to ensure all liquid has passed through the spin column.
Transfer spin columns to the correspondingly labeled, final 1.5mL centrifuge tubes. Add 200uL of buffer ATE directly onto the membrane and let incubate at room temperature for 1 minute. Centrifuge for 1 minute at 13,300 rpm to fully elute nucleic acid from the spin column into the 1.5mL centrifuge tube. Discard the spin column.
Add 800uL of RNase-free H2O to the centrifuge tubes and pipette up and down several times to mix. This is to dilute the eluted nucleic acid to the same concentration as filter paper extracted samples.
Store eluted nucleic acid in a covered container of ice until qPCR, then store at -80C.

Filter Paper Extraction
Prepare a 1.5% Chelex solution by weight using Chelex-100 resin and PCR-grade water.
Carefully cut out the circle of each dried filter paper spot and place in the corresponding labeled 1.5mL centrifuge tube. For the blank, cut out one spot from an unused filter paper card. Use a new pair of scissors for each sample.
Add 1mL of autoclaved 1X PBS to each tube containing FP spots. Ensure the FP is fully submerged in the PBS. Incubate at room temperature for 10 minutes.
Once 10 minutes has elapsed, centrifuge the samples at 13,300 rpm for 3 minutes. Discard the supernatant from each tube.
Add 1mL of autoclaved 1X PBS to each tube.
Centrifuge the samples at 13,300 rpm for 3 minutes and discard the supernatant. At this point, each tube still contains the filter paper spot.
Vortex the 1.5% Chelex and add 200uL to each sample.
The Chelex solution will separate easily. To ensure an even, homogenous amount is added to each sample, vortex the solution at least after every 3 samples.
Add 1uL of extrinsic control to each 1.5mL tube containing FP spots and place a tube sealer on each tube.
Incubate samples at 100C for 8 minutes.
Once 8 minutes has elapsed, centrifuge samples at 13,300 rpm for 2 minutes.
Transfer the supernatant from the FP spot-containing tubes to the correspondingly labeled “final” 1.5 mL tubes. Chelex beads should have sedimented at the bottom of the tube after centrifugation, but carefully transfer the supernatant to ensure no beads are included.
Store the extracted nucleic acid in a covered container of ice until qPCR, then store in -20C.
Scissor Cleaning
Place open scissors in 15% bleach solution. Use Millipore water as the diluter; do not use tap water.
Do not keep scissors in bleach solution for an extended period of time as this causes the scissors to rust much quicker.
After 1 minute, place open scissors in Millipore water.
After 1 minute, place open scissors on paper towels to dry.
Once dried, autoclave scissors on Gravity 8 setting.
Standard Curve Preparation
In a cleaned biosafety cabinet, unwrap a sterile 96-well round bottom plate. The plate can be used for preparing multiple standard curves, as long as previously used rows are marked, and 1 row of the plate is kept empty between each dilution series to reduce cross contamination.
Aliquot 12uL of RNase-free water into wells 2 through 9, leaving the first well in the row empty.
This protocol can also be completed by doubling the volume if struggling with pipetting small volumes. Add 24uL of linearized PC in well 1, 24uL of RNase-free water in wells 2-9, and transfer 8uL for each serial dilution.
Mix the stock positive control solution and add 12uL of the linearized positive control (PC) into well 1.
Transfer 4uL of the contents of well 1 (linearized PC) into well 2. Pipette up and down to mix well.
Transfer 4uL of the contents of well 2 into well 3. Mix well.
Repeat step 5 until well 9 has been added to and mixed.

If preparing two plates in one day, once the standard curve has been added to the day’s first plate, store the 96-well plate containing the original dilutions at 4C until the second plate is ready for standard curve addition.
Plating Protocol
Remove AgPath buffer and primer/probe mixes from -20C. Let them thaw briefly.
While waiting for reagents to thaw, place a qPCR plate into the PCR plate holder. Label with the experiment name and date
Create a master mix by combining the quantities of AgPath buffer, RNase-free H2O, respective primer/probe mixes, and enzyme mix as calculated here:


Immediately return all reagents to -20C.
Transfer 8uL of master mix into each well to be used on the qPCR plate.
From this step until the plate is sealed, drape a piece of aluminum foil over the top of the plate any time reagents are not actively being added into the wells. This will help to prevent light-aided degradation of the master mix components.
Add 2uL of the prepared standard curve to the wells designated in the plating diagram. Mix well after adding and use fresh pipette tips for each addition.
Add 2uL of RNase-free water to each of the wells designated as a no-template control. Mix well.
Once extracted NA has been thawed and briefly centrifuged, add 2uL into each designated well. Mix well after addition.
Once all plate components are added, carefully apply a seal to the surface of the plate. Using a roller or plate sealer, ensure that edges are fully sealed.

qPCR Run Protocol
Briefly vortex and centrifuge the plate.
Set up and run the qPCR using the following parameters:


Run Cycles

Targets and Fluorophores


Extrinsic Control Mixing
Briefly centrifuge the MS2/PhHV tube to bring the pellet to the bottom.
Add 50 µl of STD diluent to each MS2/PhHV vial to be reconstituted, mix well.
Store on ice until used in extraction processes and place the rest in -80C
If there is volume left in any of the vials, mark the top of tube with the date it was reconstituted. Store at -80C. Avoid thawing a reconstituted vial more than twice.
Primer/Probe Calculation
Primer and probe sequences:



For all hydrophilized primers, make a 100υM solution by adding PCR-grade water to the dried solution.
If the primer has a concentration of X nM, multiply that number by 10 to get the amount of PCR-grade water (in υL) to add.
Mix well and store primers at -20C.
This protocol alls for a 0.05υM concentration of primer/probe.
100uM Primer/1000ul volume= 0.1uM/1uL->0.05uM
100uM Probe/1000ul volume= 0.1uM/1uL->0.05uM
Add 100υM (180υL) of forward primer to a 1.5mL centrifuge tube.
Add 100υM (180υL) of reverse primer to the 1.5mL centrifuge tube.
Add 100υM (50υL) of forward primer to the 1.5mL centrifuge tube.
Add 590υL of PCR-grade water to the tube and vortex the primer/probe mixture to ensure it is homogenous. The total volume should be 1000υL.
Make 50υL aliquots and store at -20C.
Linearizing Positive Control
T7 promotor-Shigella-Rotovirus-Norovitus/GI-Norovirus/GII-restriction enzyme site (unique for this combined sequence, EcoRI). 363 bp.
5’-TAATACGACTCACTATAGGGAGACCTTTTCCGCGTTCCTTGACCGCCTTTCCGATACCGTCTCTGCACGCAATACCTCCGGATTCCGACCATCTACACATGACCCTCTATGAGCACAATAGTTAAAAGCTAACACTGTCAAAAACCTAAATGGCTATAGGGGCGTTATGTGACCCGCTGGATGCGATTTCATGACTTGAGCATGTGGACAGGAGATCGCAATCTACTGCCCGATTATGTAAATGATGATGGCGTCTAAGCAAGAGCCAATGTTCAGATGGATGAGATTCTCGGATCTGAGCACGTGGGAGGGCGATCGCAATCTGGCTCCCAGTTTTGTGAATGAAGATGGCGTCGAGAATTC-3’
Place all reagents into an ice bucket and allow to thaw.
Obtain a PCR tube strip and place in a clean holder. Label the top of one tube.
Add 42.5uL of PCR-grade water to the marked tube with the p100 pipette.
Shake the tube with 10x Buffer several times to mix.
Add 5uL of 10X Buffer to the marked tube with the p10 pipette.
Mix the 10nM positive control stock with a pipette.
Add 2uL of PC stock to the marked strip tube with a p2 pipette. Pipette up and down a few times to mix. Return the PC stock vial to the ice bucket.
Add 0.5uL of HindIII to the mixture with the P2 pipette, pipette up and down a few times to mix. Return the HindIII vial to the ice bucket.
Return all reagents to the -20°C freezer.
Pipette the mixture 3-4 times with the p100 pipette.
Spin the PCR strip tube briefly in a mini-centrifuge before digestion.
In a thermocycler, set up a reaction using the following parameters:

Lid: 105° C
Reaction volume: 50uL





After digestion, transfer the 50 mL of linearized PC to a separate 1.5mL tube.
Add 450uL of PCR-grade water to the tube to dilute the solution. Pipette up and down several times to mix.
Create 50uL aliquots of linearized PC and store at -20C until use.