Mar 10, 2026
Long-read PIPSeq
This protocol is a draft, published without a DOI.
- Patricia Doyle1,
- Mark Ebbert1,
- Jason A. Brandon1
- 1University of Kentucky
- Long-read PIPseq
External link: https://doi.org/10.1101/2025.10.16.682832
Protocol Citation: Patricia Doyle, Mark Ebbert, Jason A. Brandon 2026. Long-read PIPSeq. protocols.io https://protocols.io/view/long-read-pipseq-hrx2b57qf
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working.
Created: February 16, 2026
Last Modified: March 10, 2026
Protocol Integer ID: 243418
Keywords: Single cell, Long read, PIPseq, scRNA-seq, scRNAseq, read pipseq, oxford nanopore technology, isoform expression analysis with cell, pipseq, isoform expression analysis, read recovery
Funders Acknowledgements:
National Institutes of Health
Grant ID: AG078110
National Institutes of Health
Grant ID: R01AG068331
National Institutes of Health
Grant ID: GM138626
National Institutes of Health
Grant ID: NS088555
Alzheimer's Association
Grant ID: 2019-AARG-644082
BrightFocus Foundation
Grant ID: A2020161S
Disclaimer
IMPORTANT: Human blood collection for this protocol requires approval from an institutional review board (IRB) or equivalent.
Abstract
We adapted the V4.0PLUS PIPseq protocol originally developed for short-read sequencing by Fluent Biosciences to be compatible with long-read nanopore sequencing from Oxford Nanopore Technologies (ONT), combining the strengths of scRNA-seq with long-read sequencing in a benchtop-friendly design; this, in part, required small but essential modifications to the protocol, including the construction of custom oligos designed to bridge the PIPseq and ONT protocols. It also includes a custom computational approach (detailed in our preprint) designed to identify barcodes and maximize read recovery in a way that is conceptually simple but computationally challenging. In doing so, we enable isoform expression analysis with cell-type specificity.
Guidelines
IMPORTANT: Blood collection for this protocol requires institutional review board (IRB) approval.
Materials
| A | B | C | |
| Material name | Supplier | Catalog # | |
| Cell Culture Hood with UV | |||
| Centrifuge with swinging rotor | Thermo Scientific | #755007210 | |
| 15mL and 1mL centrifuge adapters | Thermo Scientific | #75005743 | |
| 2000xg Benchtop mini centrifuge compatible with 1.5mL and 0.5mL tubes | Benchmark Scientific | #C1012 | |
| Hemacytometer | |||
| 10X Microscope for cell counting | |||
| Micropipettes | Eppendorf | P1000: #3123000063 P200: #3123000055 P20: #3123000039 P10: #3123000020 | |
| PCR Thermocycler (ProFlex PCR System, 3x32-well) | Applied Biosystems | #4484073 | |
| Invitrogen Qubit Flex Fluorometer | ThermoFisher Scientific | #Q33327 | |
| Digital Vortex Mixer | Thermo Scientific | #88882009 | |
| Brandon Ultrasonics CPXH Series Ultrasonic Cleaning Bath | Fisher Scientific | #15-336-125 | |
| Femto Pulse System | Agilent | #M5330AA | |
| DynaMag-2 Magnet | Invitrogen | #12321D | |
| Laboratory balance | Fisher Scientific | #01-919-149 | |
| HulaMixer | Invitrogen | #BB3362792 | |
| PromethION 24 | ONT | #PRO-SEQ024 | |
| PromethION Data Acquisition Unit | ONT | #PRO-PRCA100 | |
| Blood Collection tube, BD Vacutainer® K2EDTA 10mL | VWR | #BDAM367525 | |
| Ficoll PAQUE Plus | Millipore Sigma | #17-1440-020 | |
| Sterile 50-mL conical tubes | Eppendorf | #0030122178 | |
| Motorized Serological Pipette Controller | BrandTech | #26333 | |
| Serological Pipettes | VWR | 25mL: #75816-090 | |
| 10mL: #75816-100 | |||
| eBioscience 10X RBC Lysis Buffer (Multi-species) | Invitrogen | #00-4300-54 | |
| Fetal Bovine Serum (FBS) | Corning | #35-015-CV | |
| Ultrapure 20X Phosphate Buffered Saline (PBS) pH 7.5 | VWR | #E703-1L | |
| Ultrapure water | |||
| PIPseq Vortex Mixer | Fluent | #FBS-SCR-DVM | |
| PIPseq Dry Bath with heated lid | Fluent | #FBS-SCR-PDB | |
| PIPseq Dry Bath 1.5mL block | Fluent | #FB0002498 | |
| PIPseq 4-tube stand, blue, for 1.5mL tubes | Fluent | #FB0004722 | |
| PIPseq Rotating vortex base assembly | Fluent | #FB0002100 | |
| 1.5mL Safe-Lock PCR Clean tubes | Eppendorf | #022363212 | |
| 0.2mL PCR 8-tube strip, domed cap | Greiner Bio-One | #373270 | |
| PCR 8-Cap strips, domed cap | VWR | #BDAM367525 | |
| 3mL syringe | |||
| 1mL syringe | |||
| G22 blunt bottom syringe needle | |||
| Standard low-retention pipette tips | Genesee Scientific | 1000uL: #24-430 200uL: #24-412 20uL: #26-404 10uL: #24-401 | |
| Wide-bore low-retention pipette tips | Genesee Scientific | 1000uL: #22-428 200uL: #22-425 | |
| 10mL serological pipettes | VWR | #75816-100 | |
| Sterile DNase-, RNase-, DNA-free 15mL tubes | Eppendorf | #0030122160 | |
| 0.2mL thin-walled PCR tubes | Genesee Scientific | #24-705 | |
| 1.5mL DNA LoBind tubes | Eppendorf | #022431021 | |
| Qubit Flex Assay Tube Strips | Invitrogen | #Q33252 | |
| PIPseq T20 3’ Single Cell RNA Ambient Kit v4.0PLUS | Fluent | #FBS-SCR-T20-4-V4.05-1 | |
| PIPseq T20 3’ Single Cell RNA 4ºC Kit v3.0 or 4.0 | Fluent | #FBS-SCR-T20-4-V3&V4-2 | |
| PIPseq T20 3’ Single Cell RNA -20ºC Kit v4.0PLUS | Fluent | #FBS-SCR-T20-4-V4.05-3 | |
| PIPseq T20 3’ Single Cell RNA -80ºC Kit v4.0PLUS | Fluent | #FBS-SCR-T20-4-V4.05-4 | |
| Qubit 1X dsDNA High Sensitivity Assay Kit | ThermoFisher | #Q33231 | |
| Genomic DNA 165kb Kit | Agilent | FP-1002-0275 | |
| PCR-cDNA Sequencing Kit V14 | ONT | #SQK-PCS114 | |
| SUPERase•In RNase Inhibitor (20U/uL) | Invitrogen | # AM2696 | |
| 100% Ethanol molecular biology grade | Millipore Sigma | #EX0276-4 | |
| Tris-EDTA (TE) Buffer 1X solution pH 8.0 | Fisher Bioreagents | #BP2473-1 | |
| IDTE (pH 8.0) | |||
| Ultrapure water | |||
| Trypan Blue Solution | PromoKine | #PK-CA902-1209 | |
| RNaseZap RNase Decontamination Solution | Invitrogen | #AM9782 | |
| 100% Ethanol molecular biology grade | Millipore sigma | #EX0276-4 | |
| Tris Base | Fisher Bioreagents | #BP152-1 | |
| HCl 5.0N | VWR | #BDH7419-1 | |
| NaCl | VWR | #0241-500G | |
| 0.5M EDTA pH 8.0 | VWR | #AM9260G | |
| Tris-EDTA (TE) Buffer 1X solution pH 8.0 | Fisher Bioreagents | #BP2473-1 | |
| Ultrapure water | |||
| AMPure XP bead-based reagent | Beckman | #A63880 | |
| M280 streptavidin 10ug/uL | Invitrogen | #11205D | |
| LongAmp Hot start Taq 2X Master Mix | New England BioLabs | #M0533S | |
| R10.4.1 flow cells | ONT | #FLO-PRO114M |
Table 1. Materials used for long-read PIPseq laboratory preparation.
| A | B | C | |
| Oligo Name | Sequence Portion | Sequence | |
| [Btn]Fwd_3580_ partial_read1_PIP | Biotin tag | 5’ - /5Biosg/ | |
| Overhang | CAGC | ||
| ONT-specific cDNA primer (cPRM) | ACTTGCCTGTCGCTCTATCTTC | ||
| PIPseq WTA Primer | CTCTTTCCCTACACGACGCTC –3' | ||
| Rev_PR2_partial_ TSO_PIP | Overhang | 5’ - CAGCT | |
| ONT-specific cDNA primer (cPRM) | TTCTGTTGGTGCTGATATTGC | ||
| PIPseq WTA Primer | AAGCAGTGGTATCAACGCAGAG - 3’ |
Table 2. Custom Oligo Sequences
Troubleshooting
Preparation before day of procedure
Label tubes with sample number (0.5mL, 50mL)
Make up 500 mL PBMC Medium (1x Phosphate Buffered Saline (PBS) pH 7.5 + 2% Fetal Bovine Serum (FBS))
Make up 1M Tris-HCl, pH 7.5
Make up 5M NaCl
Make up 0.5M EDTA, pH 8
Test pH of all reagents
Day 1: Preparation
Use UV in cell culture hood for 30-60 min.
Set one centrifuge to 20ºC, set another to 4ºC.
Prepare solutions for appropriate temperature for 15 minutes:
At room temperature: 1xPBS, PBMC Medium, Ficoll-Paque PLUS.
On ice: 50mL 1xPBS
Obtain 10mL blood that has been collected in Blood Collection Tube and kept at room-temperature on a rocker until pickup, ideally within 1.5 hours of collection.
After bringing blood back to the laboratory, place blood tube on rotating mixer for 10 minutes to resuspend blood cells.
Day 1: Isolation of PBMCs
Invert the Ficoll-Paque PLUS bottle several times to ensure thorough mixing.
Placing the serological pipette tip through the central hole in the insert, aliquot 15mL Ficoll-Paque PLUS for each sample into labeled 50mL SepMate tube and keep at RT.
NOTE: Make sure there is 1-2mL above the Sepmate insert.
Gently mix blood with serological pipette before transferring blood sample to new labeled 50mL tube.
NOTE: Each 50mL Sepmate tube can accommodate between 5 and 17mL of blood.
Dilute the blood sample 1:1 with an equal volume of PBMC Medium to blood
Keeping Sepmate tube in upright position, quickly pipette diluted sample down the side of the tube.
Spin down samples at 1200xg for 10 min @ 20ºC+ at max break and acceleration.
During spin, remove -80C PIP-seq kit from freezer and put 1 tube Cell Suspension Buffer and PIPs at room temp for 15 minutes before placing on ice.
Preheat PIPseq dry bath to 25ºC on setting A. (hold @ 25ºC hold, 15 min @ 25ºC, 45 min @ 37ºC, 10 min @ 25ºC, hold @ 15-25ºC)
In one smooth motion, gently pour top layer of sample into new labeled 50mL tube.
NOTE: Do not leave the tube inverted for more than 2 sec. Minimize the amount of time held at a diagonal, as this is when RBCs will escape the insert.
Bring PBMC tube sample to a final volume of 50mL with PBMC Medium.
Spin tubes at 300xg for 10 min @ 4ºC on acceleration 9 and break 9.
Aspirate supernatant until ~5mL remaining.
Gently tap the bottom of the tube to break up pellet and bring PBMCs to final volume of 50mL with PBMC Medium.
Spin tubes at 200xg for 8min @ 4ºC on acceleration 9 and break 1.
Aspirate as much of the supernatant as possible without disturbing the cell pellet.
If pellet is red, perform red blood cell lysis as follows:
Add 1mL RBC lysis buffer, pipette gently to mix, and incubate up to 5 min at 4ºC.
After incubating, add ice cold PBS to tube until liquid reaches 14mL and invert to mix.
Centrifuge for 10 min at 900xg at 4ºC max acceleration and break.
When pellet is no longer red, aspirate supernatant and gently tap tube to dissociate pellet before adding 1 mL cold Cell Suspension Buffer and slowly mix 5X with P1000 wide-bore pipette tip.
Spin down samples at 300xg for 3min @ 20ºC. Aspirate as much of the supernatant as possible without disturbing the cell pellet.
With standard bore tip, add 500μL of cold PIPseq Cell suspension Buffer. Using WIDE-BORE tip, gently mix 10-15x until cells are completely resuspended.
Day 1: Cell Counting
Add 30uL 0.05% trypan blue to 10uL cells and count 10uL in hemacytometer. Dilute as needed and take note for live cell count calculations.
Calculate concentration of cells per μL using the following formula:
Cells/μL = (total live cell count/number of fields counted) * 10 * 1mL * Dilution factor
Determine the volume of cell suspension buffer to add or remove to reach a targeted concentration of 7500 cells/μL, using the following formula:
Volume buffer to add = (Volume cell suspension at counting) - (((cells/μL) * (Volume at counting))/Targeted concentration)
Day 1: PIPseq-Cell Capture and Lysis
Pull RNase inhibitor from -20ºC.
Once PIPs have fully thawed, centrifuge for ~5 sec on benchtop minifuge to remove air bubbles, then place on ice.
Using a wide-bore pipette tip, prepare cell suspension in PIP-seq Cell Suspension Buffer at a concentration of 7500 live cells per μL:
Centrifuge for 6 min at 300xg at 4ºC max acceleration and break.
Remove (excess) supernatant with P1000 pipette and gently tap tube to dissociate pellet and bring to desired final volume. Place on ice.
Repeat cell counts to ensure accurate concentration and >90% viability before loading.
Mix cell suspension 10X with wide-bore P200 set to 80% of cell suspension volume, then add exactly 8μL of cells directly into PIPs mixture while avoiding creating air bubbles.
NOTE: if working with multiple samples, add cells to all of them sequentially before moving on to the next step.
Add 2uL RNase inhibitor at 20U/μL directly into PIPs mixture while avoiding creating air bubbles.
Mix cell:PIP mixture very slowly 10X using standard bore, low-retention P200 tip at 180μL while moving tip throughout mixture starting from the bottom and moving slowly throughout the mixture and returning to the bottom. Use very slow, even strokes, ensuring that the emulsion is released along the inner side wall of the tube, and that the pipette was not pushed to the second stop until mixing is complete.
NOTE: Be careful not to create air bubbles, especially in first 6 strokes. Although a small
number of bubbles are alright, if excessive foaming occurs, briefly centrifuge on the minifuge to remove. Excessive centrifugation can cause removal of cells from PIPS and should be used sparingly.
Add 1000μL Partitioning Reagent along the side of the tube to cell:PIP mixture using P1000.
Tightly seal caps and place tubes in rotating vortex adapter in the horizontal configuration (facing forward), ensuring tubes are fully depressed into the adapter, and vortex at 3000 RPM for 15 sec.
Using 3mL syringe attached with G22 blunt tip syringe, slowly move tip through emulsion to bottom of tube and wait 5 seconds. Slowly transfer bottom layer (partitioning reagent) out of each tube until
bottom of PIPs+cells separation line is aligned with the low (“L”) marker of the tube rack.
Prepare the Chemical Lysis Emulsion by adding 630μL of Partitioning reagent to the CLB3 tube containing chemical lysis buffer.
Vortex for 10 seconds to generate the emulsion and immediately use a P1000 tip to add the entire volume of Chemical Lysis Emulsion (~840μL) on top of each PIP emulsion.
Mix the combined emulsions gently by inversion 10 times. It should look cloudy.
Check that the PIP-seq Dry Bath is preheated to 25ºC, with the lid set to +5ºC, and has preheated for at least 10 minutes. Insert samples into the dry bath and skip to the next step to begin the lysis incubation.
Hold samples at +20ºC overnight before proceeding to mRNA isolation.
Day 2: Preparation
Take PIPseq Breaking Buffer out of 4ºC fridge and place at room temp for minimum 10 min.
Make 12mL aliquot of PIPseq Washing Buffer for each sample and label Wash 1. Place on ice.
Thaw PIPseq TSO on ice after removing from -80ºC freezer storage.
Thaw PIPseq RT Additive Mix on ice after removing from -20ºC freezer storage
Day 2: PIPSeq-mRNA Isolation
Place PIP tubes into 1.5mL stand. Place tip of 1mL syringe with G22 blunt bottom syringe needle through emulsion slowly until it touches bottom of tube, then wait 5 seconds. Slowly aspirate out the bottom phase until the top of the emulsion is level with the middle marker (“M”) on the tube stand. Save syringe for future steps.
NOTE: It is acceptable to leave a few μL of partitioning fluid to avoid aspirating PIPs.
Slowly add 750μL of Breaking Buffer to each sample.
Slowly add 200μL of PIPseq De-partitioning reagent to each sample along the side wall of the tube.
Securely close the lid and invert 14X to break emulsion. DO NOT VORTEX.
Centrifuge 5-10 sec on a benchtop minifuge. Begin timing when minifuge reaches top speed.
CRITICAL NOTE: Ensure emulsion is completely broken by visually confirming there is a clear interface
between the bottom dark pink phase and the aqueous layer containing the PIPs. If droplets of red precipitate is detected between the layers, remove them before the rest of the bottom phase in the next step.
Using a 1 mL syringe attached to a G22 blunt tip syringe, slowly move tip through the emulsion to the bottom of the tube and wait 5 seconds. Slowly remove the pink-colored bottom phase (250-300μL) from each tube of PIPs. If a red droplet is present between layers, aspirate to remove it first, then proceed to the removal of the remaining pink bottom phase.
Centrifuge for <2 seconds on bench-top minifuge. Begin timing when the minifuge reaches top speed.
Remove any remaining pink-colored bottom phase with a P20 pipette tip, moving very slowly in a circular motion at the bottom of the tube to ensure all of the bottom phase is gone. Place the tubes on ice.
Perform the first wash:
Using a P1000 low-retention tip, transfer PIPs into chilled Wash 1. Wash the inside of the pipette tip inside the 15mL tube by aspirating up and down 3X.
Briefly spin the tube in the microfuge to collect all PIPs in bottom of tube. Aspirate remaining PIPs from 1.5mL tube and dispense into “Wash 1” tube. If droplets remain in pipette tip, aspirate up and down at least 3X.
Wash 1.5mL tube with 1mL of Wash 1, invert to mix, and transfer fluid back to Wash 1.
Gently mix each tube by tapping the bottom to disperse pellet and invert 10X.
Centrifuge at 750xg on low break (70-80% of break) for 2 min in centrifuge with swinging bucket rotor to pack PIPs. There should be a noticeable pellet on bottom of tube after centrifugation.
SLOWLY aspirate supernatant with clean tip until ~1mL remains while keeping tip at top of the liquid level without disturbing pellet.
During washes, weigh a clean 1.5mL Safe-Lock Eppendorf tube for each sample and record the mass in mg.
Perform a second wash:
Add 12mL of Washing Buffer from Stock bottle directly into “Wash 1” tube with PIPs to complete the second wash.
Gently mix each tube by tapping the bottom to disperse pellet and invert 10X.
Centrifuge at 750xg on low break for 2 min in centrifuge with swinging bucket rotor to pack PIPs. There should be a noticeable pellet on bottom of tube after centrifugation.
Aspirate supernatant with clean tip until ~1mL remains.
Perform a third wash:
Add 12mL of Washing Buffer from Stock bottle directly into “Wash 1” tube with PIPs to complete the third and final wash.
Gently mix each tube by tapping the bottom to disperse pellet and invert 10X.
Centrifuge at 750xg on low break for 2 min in centrifuge with swinging bucket rotor to pack PIPs. There should be a noticeable pellet on bottom of tube after centrifugation.
Aspirate supernatant with clean tip until ~1mL remains.
Transfer~1mL PIP mixture into pre-tared 1.5mL tube using standard P1000 low-retention tip.
Weigh and record the mass of each tube containing PIPs, then convert it to volume using the equation below. Calculate the aspiration volume necessary to normalize each mixture volume to 250μL:
Volume to remove = (Total mass - Tube mass) - 250μL
Centrifuge for ~30 sec on benchtop minifuge.
Aspirate and discard the designated volume of Washing Buffer before putting samples on ice.
NOTE: If you are touching the PIP layer as you remove the designated volume, spin down tubes for 30 sec to clear out more supernatant volume.
Day 2: PIPseq-cDNA Synthesis
Prepare the following cDNA synthesis Reaction Mastermix reaction on ice. Multiply the volume based on the number of samples so an appropriate amount of mastermix reaction is produced:
236.5 μL RT Additive Mix
22 μL TSO
16.5 μL RT Enzyme Mix
Mix Mastermix well by pipetting, then add 250μL of Mastermix to each 1.5mL tube of PIPs and mix well by flicking or tapping tube to break up pellet and inverting the tube 20X.
Briefly centrifuge on benchtop minifuge.
Perform cDNA synthesis with the following protocol in the PIPseq dry bath with the lid set to 105ºC: (30 minutes @ 25ºC, 90 minutes @ 42ºC, 10 minutes @ 85ºC, HOLD @ 4ºC)
During cDNA synthesis, perform the following preparation steps:
Make up 3mL 0.5X Washing Buffer per sample and put on ice
Take 4X PCR Mastermix and WTA primer our of -20ºC freezer and thaw on ice.
Pipette-mix 4X PCR Mastermix and WTA primer 10X, centrifuge, and put back on ice.
Centrifuge 1.5mL tube for 30 seconds on a benchtop minifuge.
Aspirate and discard 300μL of supernatant without disturbing PIPs pellet.
Perform first wash step:
Add 1mL 0.5X Washing Buffer to each PIP tube for first wash.
Vortex PIP tube for 5 seconds @ 3000RPM on PIP-seq vortex.
Centrifuge for ~30 sec on benchtop minifuge.
Aspirate and discard 800μL of supernatant without disturbing PIPs pellet.
Perform second wash step:
Add 800μL 0.5X Washing Buffer to each PIP tube for the second wash.
Vortex PIP tube for 5 seconds @ 3000RPM on PIP-seq vortex.
Centrifuge for ~30 sec on benchtop minifuge.
Aspirate and discard 800μL of supernatant without disturbing the PIPs pellet.
Perform third wash step:
Add 800μL 0.5X Washing Buffer to each PIP tube for the second wash.
Vortex PIP tube for 5 seconds @ 3000RPM on PIPseq vortex.
Centrifuge for ~30 sec on benchtop minifuge.
Aspirate and discard 800μL of supernatant without disturbing the PIPs pellet.
Weigh and record the mass of each tube containing PIPs, then convert it to volume using the equation below. Calculate the aspiration volume necessary to normalize each mixture volume to 250μL:
Volume to remove = (Total mass - Tube mass) - 250μL
Centrifuge for 30 seconds on benchtop minifuge.
Remove designated amount of supernatant to yield 250uL total volume.
Proceed immediately to cDNA amplification.
Day 2: PIPseq-cDNA Amplification
Prepare the WTA Mastermix, multiplying for each sample:
94.4 μL WTA Buffer Mix
1.87 μL WTA Primer
Vortex WTA Mastermix briefly.
Add 85.7μL WTA master mix into each RT product mix.
Mix by vortexing briefly (5 sec @ 3000RPM on PIPseq vortexer)
Distribute the WTA reaction mixture into 8 x 42μL aliquots in Greiner Bio-One 8-tube strip. Label appropriately so samples can be recombined after cDNA amplification. For the last aliquot, briefly centrifuge 1.5mL tube and transfer all residual volume to Greiner Bio-One 8-tube strip.
Run the following PIPseq cDNA Amplification program on the thermocycler with the lid set to 105ºC:
3 min @ 95ºC (1 cycle)
15 sec @ 98ºC, 4 min 20 sec @ 69ºC (15 cycles)
5 min @ 72ºC (1 cycle)
HOLD @ 4ºC
Store samples at 4ºC overnight.
Day 3: Preparation
Start NaOH rinse in Femto Pulse.
Take the Femto Pulse reagents out of the 4ºC fridge to bring to room temperature.
Day 3: PIPseq-Isolate cDNA from PIPs
Add 75μL of CE Buffer from PIPseq Ambient kit to each WTA reaction.
Vortex mix (quickly tap 5X @ 3000 rpm) and spin down ~30 sec on benchtop minifuge.
Slowly pool all WTA products from the same sample into a 1.5mL tube per sample.
Spin down tube strip once more to ensure all of the sample is collected.
Briefly vortex (quickly tap 5X @ 3000 rpm) 1.5mL tubes and spin down ~30 sec.
Slowly transfer 300μL of supernatant into new labeled 1.5mL tube. Repeat.
Briefly spin down supernatant and examine bottom of tube for PIPs. If present, transfer supernatant once more to new 1.5mL tube.
Measure the final volume of the supernatant with a pipette and adjust the magnetic bead ratio (0.8X volume of sample) if it is not 600μL.
Thoroughly vortex bottle of SPRI beads to mix (<30 sec).
Add 480μL SPRI to 600μL samples for a final SPRI bead ratio of 0.8x.
Gently flick the sample to mix and incubate on a hula mixer 10min at room temperature.
During incubation, make 2.1mL fresh 85% ethanol per sample.
Briefly spin down. Place 1.5mL tubes in the magnetic stand and bind to the magnet for 5 min.
ON MAGNET: Remove and discard supernatant without touching SPRI beads.
ON MAGNET: Carefully wash 2x with 1mL 85% ethanol for 30 sec each without disturbing SPRI
beads.
ON MAGNET: Remove final traces of ethanol with P20 or P200 pipette without disturbing SPRI beads.
ON MAGNET: Air dry for up to 5 min with an open tube top to remove any residual ethanol, without over-drying. SPRI beads should still look glossy, not cracked.
ON MAGNET: Remove any remaining traces of ethanol with P20 or P200 pipette without disturbing beads.
Remove tubes from magnetic rack and add 52μL IDTE (pH 8.0) over SPRI pellet on side of tube until fully washed off the tube.
Pipette mix slowly 10X with a wide-bore pipette tip.
Gently flick the sample to mix and incubate on a hula mixer for 5 min at room temperature.
Briefly centrifuge on bench top minifuge (~2 sec).
Incubate for 5 min at room temp.
Place tubes into the magnetic rack and bind to the magnet for 2 min.
Using a wide-bore pipette tip, remove and save 50μL of supernatant in a new 1.5mL LoBind Eppendorf tube. Do not disturb the SPRI beads while removing the supernatant.
Do remove any remaining beads, place tube with newly collected supernatant tube on the magnet for 2 min.
Using a wide-bore pipette tip, remove and save 50μL of the supernatant in a new 1.5mL LoBind Eppendorf tube. Do not disturb the SPRI beads while removing the supernatant.
Day 3: Quality Control-cDNA Qubit Quantification
Dilute Qubit dsDNA High Sensitivity (HS reagent 1:200 in Qubit dsDNA HS Buffer for Qubit working
solution. (21μL Qubit dsDNA HS reagent, 4179μL Qubit dsDNA HS Buffer)
Aliquot 2μLof each sample into new 200μL tube, ensuring at least 2 replicates.
Add 8μL working solution to each sample tube for final volume of 10μL.
Sonicate 3 min.
Add 190μL working solution to each sample tube for final volume of 200μL.
Vortex 3-5 seconds, centrifuge briefly, and allow all tubes to incubate 10 min at room temp.
Touch “Run Samples”. On assay screen, select sample volume and units and set to 2μL.
Insert sample into sample chamber, close lid, and touch “Run Samples”. When reading is complete, remove sample tube.
Record sample concentrations.
Day 3: Quality Control-cDNA Fragment Analysis on Femto Pulse
Dilute samples to 0.5ng for use with standard Femto Pulse gDNA 165kb protocol.
Prepare new gel, inlet buffer, 0.5N NaOH solution, and Conditioning solution. Check that the storage solution and rinse buffer are sufficient.
Plate 2μL samples and 18μL diluent for standard protocol and run overnight.
Days 4 and 5: ONT-Pre-pull-down PCR
Because of a legal agreement with ONT, we are unable to disclose the specific steps of the ONT portions of these protocols. For clarity, these will be referred to as “Single-cell ONT protocol” and “V14 protocol”, respectively. This protocol was designed with the updated ONT R10 chemistry in mind.
Briefly, this protocol used PCR to attach custom oligos, which ensured compatibility of the PIPseq-generated cDNA with the ONT cPRM. Biotin-mediated size selection was conducted to ensure the isolation of reads with the custom oligos. PCR was again performed to attach the isolated transcripts to the ONT cDNA Primer (cPRM) before performing a quality check, as described in the Quality Control (QC) sections of this protocol. The next day (Day 5), the adapter containing the motor protein was attached to each strand, and the sample was fed into flow cells in the PromethION.
The following changes were made to these protocols:
- Any time either ONT protocol called for the cDNA sample to be vortexed, we instead pipetted very gently 10-20 times with a wide-bore pipette tip to mix.
- The ONT single-cell method was designed to be used with single-cell barcoded cDNA produced with the 10X Genomics Next GEM Single Cell 3’ Kit (V3.1). Our modifications to this protocol utilize cDNA amplicons produced using the long-read PIPseq (V4.0PLUS) protocol above. As such, we recommend the modified custom oligos described in the “Custom Oligos for Adaptation of PIPseq cDNA for ONT Sequencing” methods section, which were designed to bridge the ONT and PIPseq sections of the protocol to ensure compatibility. Below are these oligos:
Custom Oligo Sequences:
[Btn]Fwd_3580_partial_read1_PIP sequence: 5’-/5Biosg/CAGCACTTGCCTGTCGCTCTATCTTCCTCTTTCCCTACACGACGCTC -3’
Rev_PR2_partial_TSO_PIP sequence:
5’-CAGCTTTCTGTTGGTGCTGATATTGCAAGCAGTGGTATCAACGCAGAG-3’
- Sequencing preparation for the ONT protocol was intended to be performed using the PCR-cDNA Sequencing Kit (ONT, #SQK-PCS111) with PromethION R9.4.1 flow cells (ONT #FLO-PRO002). Our protocol utilizes the updated ONT PCR-cDNA Sequencing Kit V14 (ONT #SQK-PCS114) with PromethION R10 flow cells (ONT, #FLO-PRO0000).
- The standard protocol uses a AMPure XP bead ratio of 0.8X for both the “Pre-Pull-Down” and “Post-Pull-Down” bead enrichment steps, we instead used a ratio of 0.7X.
- Bead washing for the “Pull-down” section of the protocol (steps 1-7 in single-cell ONT protocol, “Pull-down” section), was performed during the pre-pull-down PCR cycling to increase efficiency.
- Targeting three flow cells, we aimed to recover >210ng cDNA before sequencing.
- After Post-Pull-Down, QC was performed and concentration was assessed using the standard protocols for the Qubit High Sensitivity Kit and Femto Pulse gDNA 165kb kit, as described in the Quality Control sections of this protocol.
- Starting at the “Adapter Addition” section of the ONT single-cell protocol, we followed the adapter addition, priming, and flow cell loading steps contained within the “cDNA-PCR Sequencing V14 (SQK-PCS114)” protocol.
- The average amplicon size from the Agilent Femto Pulse Bioanalyzer was used to calculate the required sample volume for 70 fmol and diluted into 31µL of Elution Buffer (EB).
- Just before loading the samples into the flow cells, the sample tubes were gently flicked to mix.
- We waited a minimum of 20 minutes after loading the library into the flow cells before initiating sequencing. Sample cDNA libraries were sequenced continuously until the end of the flow cell life.
Protocol references
Doyle, P. H. et al. Decoding the human PBMC isonome: Isoform-level resolution with single-cell
long-read transcriptomics. Preprint at https://doi.org/10.1101/2025.10.16.682832 (2025).
Clark, I. C. et al. Microfluidics-free single-cell genomics with templated emulsification. Nat
Biotechnol https://doi.org/10.1038/s41587-023-01685-z (2023)
doi:10.1038/s41587-023-01685-z.
Acknowledgements
P.H.D., M.T.W.E., and J.A.B. conceived and designed the study. P.H.D. designed modifications to the
long-read PIPseq protocol and performed all experiments.