Mar 13, 2020
- Iain MacArthur1,
- Stacy Ramkissoon1,
- Andrew Preston1
- 1[Milner Centre for Evolution, Department of Biology and Biochemistry, University of Bath, Bath, UK]
External link: https://doi.org/10.1371/journal.pone.0232334
Protocol Citation: Iain MacArthur, Stacy Ramkissoon, Andrew Preston 2020. Live/Dead qPCR of B. pertussis IS481. protocols.io https://dx.doi.org/10.17504/protocols.io.bc5niy5e
Manuscript citation:
Ramkissoon S, MacArthur I, Ibrahim M, Graaf Hd, Read RC, Preston A (2020) A qPCR assay for Bordetella pertussis cells that enumerates both live and dead bacteria. PLoS ONE 15(4): e0232334. doi: 10.1371/journal.pone.0232334
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: March 02, 2020
Last Modified: March 13, 2020
Protocol Integer ID: 33678
Keywords: enumeration, live, dead, qPCR, propidium monoazide, PMA,
Abstract
This protocol describes the use of qPCR for the quantitative determination of live B. pertussis bacteria in a sample. The method uses propidium monoazide, a compound that can cross the cell wall of dead bacteria and binds DNA following photo activation to inhibit amplification of DNA from dead bacteria. This method uses a TaqMan probe specific to IS481 to ensure maximum sensitivity due to the high copy number of the target. Although IS481 is not specific to B. pertussis for experimental purposes it provides acceptable specificity.
Attachments
Materials
MATERIALS
Water
Centrifuge
Microcentrifuge
Microcentrifuge tubesDenville Scientific Inc.Catalog #C2170
StepOnePlus™ Real-Time PCR System Thermo Fisher ScientificCatalog #4376600
MicroAmp™ Fast Optical 96-Well Reaction Plate, 0.1 mLThermo FisherCatalog #4346907
TaqMan™ Gene Expression Master MixThermo FisherCatalog #4369016
Adhesive PCR Plate SealsThermo FisherCatalog #AB0558
PMA-Lite™ LED Photolysis DeviceBiotiumCatalog #E90002
1.5 ml Crystal Clear Microcentrifuge TubeStarLabCatalog #E1415-1500
QIAamp DNA Mini KitQiagenCatalog #51304
RNase AMerck MilliporeSigma (Sigma-Aldrich)Catalog #R4642
PMA Dye 20 mM in H2OBiotiumCatalog #40019
1000 µl Filter Tip (Sterile) RackedStarLabCatalog #S1126-7810
200 µl Graduated Filter Tip (Sterile) RackedStarLabCatalog #S1120-8810
20 µl Bevelled Filter Tip (Sterile) RackedStarLabCatalog #S1120-1810
10 µl Graduated Filter Tip (Sterile) RackedStarLabCatalog #S1121-3810
Primers (IS481F/R)
Probe (IS481)
Control DNA for standard curve (Purified DNA from B1917 or strain being tested)
| Sequence (5’-3’) | ||
| IS481 Forward Primer | ATCAAGCACCGCTTTACCC | |
| IS481 Reverse Primer | TTGGGAGTTCTGGTAGGTGTG | |
| IS481 Probe | FAM-AATGGCAAGGCCGAACGCTTCA-BHQ1 |
Primers (IS481F/R) and Probe (IS481)
Safety warnings
Good Laboratory Practice must be followed. Wear laboratory coats and gloves.
Before start
Principle
To use propidium monoazide (PMA) to inhibit the PCR amplification signal of DNA from dead bacteria. Purified DNA will be used as a template for the quantification of IS481 using a TaqMan probe. A standard curve consisting of DNA from pure B1917 will be used to determine absolute quantity in unknowns.
PMA treatment
PMA treatment
Pellet fresh samples by centrifuging at 2,000 x g for 10 minutes and resuspend in 1.2 ml of PBS.
10m
Transfer 200µl of resuspended sample into two clear microfuge tubes (continue with 1 sample to Step #3 and 1 sample skip to Step #4).
Add 0.5µl of PMA to one of the 200µl of samples from Step #2.
Incubate microfuge tubes in the dark for 10 min at room temperature. Cover samples with aluminium foil and incubate on a rocker.
10m
Expose samples to light using the PMA-Lite™ LED Photolysis Device for 5 min.
5m
DNA purification
DNA purification
Add 20µl of QIAGEN Protease and 4 µl of RNase A.
Add 200µl of Buffer AL and vortex for 15 s.
15s
Incubate at 56ºC for 10 min.
10m
Briefly spin tube to recover condensation.
Add 200µl of ethanol (96-100%), vortex and spin briefly.
Add to spin column and centrifuge for 1 min at 6000xg.
1m
Transfer to a new collection tube.
Add 500µl AW1 buffer and spin for 1 min at 6000xg.
1m
Transfer to a new collection tube.
Add 500µl AW2 buffer and spin for 3 min at 17000xg
3m
Transfer to a 2ml microfuge tube.
Spin at max speed for 1 min.
1m
Transfer to a 1.5ml microfuge tube.
Add 200µl of Buffer AE and incubate at room temperature for 1 min.
1m
Elute by centrifuging for 1 min at 6000xg.
1m
qPCR
qPCR
Dilute stock primers (50µM) 9 in 50µl, to give a reaction concentration of 900nm.
Dilute stock probe (50µM) 3 in 100µl, to give a reaction concentration of 150nm.
Prepare Mastermix as follows:
| Taqman MM | 10µl | 1x | |
| Forward primer | 2µl | 900nM | |
| Reverse primer | 2µl | 900nM | |
| Probe | 2µl | 150nM |
Mastermix per reaction
Add 16µl of master mix per well.
Serial dilute 9 times, 5:50 positive control DNA (25ng/ul).
Use dilutions 3-9 for 1000, 100, 10, 1, 0.1, 0.01, 0.001pg.
Load in triplicate 4µl of DNA for each control dilution, unknown and water samples.
PCR and analysis
PCR and analysis
Cover plate with film and spin for 1 min at 1000xg
1m
Set up qPCR program as follows:
| 50ºC | 2min | ||
| 95ºC | 10min | ||
| 40 cycles: | 95ºC | 15sec | |
| 60ºC | 1min |
qPCR Cycle
Results
Results
Run analysis on data using StepOnePlus™ Software v2.3.
Outliers of triplicate samples should be ignored (omit).
Confirm standard curve has an r2 >0.95.
Convert pg of DNA to copy number: B. pertussis/sample=(50x(mass of template in pg)x6.022x1023)/length of genome in bp*1x1012x650).
Untreated sample (no PMA), represents total B. pertussis in the sample.
PMA treated sample gives number of live B. pertussis in the sample.
The number of dead can be determined from the difference between untreated and treated.