Oct 10, 2022
  • Jocelyn Y. Kishi1,2,3,4,
  • Ninning Liu1,2,3,
  • Emma R. West5,6,3,
  • Kuanwei Sheng1,2,
  • Jack J. Jordanides1,2,
  • Matthew Serrata1,2,
  • Constance L. Cepko5,6,7,4,
  • Sinem K. Saka1,2,8,4,
  • and Peng Yin1,2,4
  • 1Wyss Institute for Biologically Inspired Engineering, Harvard University, Boston, Massachusetts 02115, USA.;
  • 2Department of Systems Biology, Harvard Medical School, Boston, Massachusetts 02115, USA;
  • 3These authors contributed equally;
  • 4Co-corresponding;
  • 5Department of Genetics, Blavatnik Institute, Harvard Medical School, Boston, Massachusetts 02115, USA;
  • 6Howard Hughes Medical Institute, Chevy Chase, Maryland 20815, USA;
  • 7Department of Ophthalmology, Harvard Medical School, Boston, Massachusetts 02115, USA;
  • 8European Molecular Biology Laboratory (EMBL), Genome Biology Unit, 69117 Heidelberg, Germany
Icon indicating open access to content
QR code linking to this content
Protocol CitationJocelyn Y. Kishi, Ninning Liu, Emma R. West, Kuanwei Sheng, Jack J. Jordanides, Matthew Serrata, Constance L. Cepko, Sinem K. Saka, and Peng Yin 2022. Light-Seq. protocols.io https://dx.doi.org/10.17504/protocols.io.x54v9jno4g3e/v1
Manuscript citation:
Kishi, J.Y., Liu, N., West, E.R. et al. Light-Seq: light-directed in situ barcoding of biomolecules in fixed cells and tissues for spatially indexed sequencing. Nat Methods (2022). https://doi.org/10.1038/s41592-022-01604-1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: August 29, 2021
Last Modified: October 10, 2022
Protocol Integer ID: 52794
Keywords: rapid photocrosslinking of dna, situ sequencing, dopaminergic amacrine cell, transcriptome sequencing, retinal section, rare neuronal subtype, complementary dnas in situ, sequencing library, multiplexed spatial indexing, directed dna, barcoding infixed cell, step dna stitching reaction, biomarkers fora, multiple cell population, rapid photocrosslinking, discovered biomarkers fora, approach for multiplexed spatial indexing, complementary dna
Funders Acknowledgements:
HHMI
Abstract
We present Light-Seq, an approach for multiplexed spatial indexing of intact biological samples using light-directed DNA barcoding infixed cells and tissues followed by ex situ sequencing. Light-Seq combines spatially targeted, rapid photocrosslinking of DNA barcodes onto complementary DNAs in situ with a one-step DNA stitching reaction to create pooled, spatially indexed sequencing libraries. This light-directed barcoding enables in situ selection of multiple cell populations in intact fixed tissue samples for full-transcriptome sequencing based on location, morphology or protein stains, without cellular dissociation. Applying Light-Seq to mouse retinal sections, we recovered thousands of differentially enriched transcripts from three cellular layers and discovered biomarkers fora very rare neuronal subtype, dopaminergic amacrine cells, from only 4–8 individual cells per section. Light-Seq provides an accessible workflow to combine in situ imaging and protein staining with next generation sequencing of the same cells, leaving the sample intact for further analysis post-sequencing.
Materials
PBS - Phosphate-Buffered Saline (10X) pH 7.4Invitrogen - Thermo FisherCatalog #AM9625

DNAse/RNAse free distilled waterInvitrogenCatalog #10977023

Maxima H Minus Reverse Transcriptase (200 U/µL)Thermo FisherCatalog #EP0753

RNaseOUT™ Recombinant Ribonuclease InhibitorInvitrogen - Thermo FisherCatalog #10777019

Triton X-100Merck MilliporeSigma (Sigma-Aldrich)Catalog #T8787-50ML

Terminal Transferase - 2,500 unitsNew England BiolabsCatalog #M0315L

2′3′-Dideoxyadenosine 5′-Triphosphate 100 mM solutionMerck MilliporeSigma (Sigma-Aldrich)Catalog #GE27-2051-01

Deoxynucleotide Solution Set - 25 umol of eachNew England BiolabsCatalog #N0446S (only need dATP)

Deoxynucleotide Solution Mix - 8 umol of eachNew England BiolabsCatalog #N0447S

Ethyl alcohol, Pure 200 proof, for molecular biology Merck MilliporeSigma (Sigma-Aldrich)Catalog #E7023

Qubit™ 1X dsDNA High Sensitivity (HS) and Broad Range (BR) Assay KitsInvitrogen - Thermo FisherCatalog #Q33230

Sodium Chloride (5M)Invitrogen - Thermo FisherCatalog #AM9760G

Formamide (Deionized)Thermo FisherCatalog #AM9342

Bst DNA Polymerase Lg Frag - 8,000 unitsNew England BiolabsCatalog #M0275L

RNase H - 1,250 unitsNew England BiolabsCatalog #M0297L

KAPA HiFi DNA PolymeraseKapa Biosystems

SYBR™ Green I Nucleic Acid Gel Stain - 10,000X concentrate in DMSOThermo FisherCatalog #S7563

Agencourt AMPure XPBeckman CoulterCatalog #A63880

10 x 2 ml IDTE pH 7.5 (1X TE Solution)IDTCatalog #11-01-02-02

Tween 20Merck MilliporeSigma (Sigma-Aldrich)Catalog #P9416-50ML

Pierce™ 16% Formaldehyde (w/v), Methanol-freeThermo FisherCatalog #28908

SecureSeal™-SA8S-1.0 8-7mm X 7mm X 1.0mm DepthGrace Bio-LabsCatalog #621102 OR µ-Slide 8 Well Poly-L-Lysine Coated #1.5 Polymer CoverslipIbidi

Poly-D-Lysine HydrobromideMerck MilliporeSigma (Sigma-Aldrich)Catalog #P6407-5MG

Pierce™ 20X Borate BufferThermo FisherCatalog #28341

Tissue-Tek OCTFisher ScientificCatalog #14-373-65

ThermoPol Reaction Buffer Pack - 6.0 mlNew England BiolabsCatalog #B9004S

Sucrose molecular biology gradeMerck MilliporeSigma (Sigma-Aldrich)Catalog #S0389

Nextera DNA library preparation kit 24 samplesCatalog #FC-121-1030

Sheared Salmon Sperm DNA 10mg/mLThermo Fisher ScientificCatalog #AM9680

Dextran Sulfate 50% SolutionMerck MilliporeSigma (Sigma-Aldrich)Catalog #S4030



Equipment
Equipment
Qubit
NAME
Flurometer
TYPE
Invitrogen
BRAND
Q33228
SKU
LINK
(or equivalent for measuring dsDNA concentration)
Equipment
Eppendorf Mastercycler® nexus flat
NAME
Eppendorf
BRAND
71003-568
SKU

Equipment
Magnetic Separator
NAME
10X Genomics
BRAND
120250
SKU
(or equivalent)


Microscope capable of delivering UV light to regions of interest.




Oligos

Note: Not all S5XX.GATE and Next.N7XX primers are needed. Consult protocol for clarification.
ABCDE
NameDescriptionSequenceSupplierPurification
RT.5N.3GRT PrimerTTTACACGATTGAGTTATNNNNNGGGIDTHPLC
GATE.D12.B1Barcode sequence 1 - Cy5 labeled barcode strand. GGAGTTGGAGTGAGTGGATGAGTGATGDDDDDDDDDDDDTATGGATGAGTTATATAACTCA[cnvK]TCGTGTAAAT[Cy5-3]GeneLinkPAGE
GATE.D12.B2Barcode sequence 2 - Cy3 labeled barcode strand. GGAGTTGGAGTGAGTGGATGAGTGATGDDDDDDDDDDDDGTTAGGTGAGTTATATAACTCA[cnvK]TCGTGTAAAT[Cy3-3]GeneLinkPAGE
GATE.D12.B3Barcode sequence 3 -Fluorescein (FITC) labeled barcode strand. GGAGTTGGAGTGAGTGGATGAGTGATGDDDDDDDDDDDDAGGGTATGAGTTATATAACTCA[cnvK]TCGTGTAAAT[Fl-3]GeneLinkPAGE
GATC.20TPrimer for Cross-Junction SynthesisGAGAATGTGAGTGAAGATGTATGGTGATTTTTTTTTTTTTTTTTTTTIDTHPLC
GATEPCR Primer 1GGAGTTGGAGTGAGTGGATGAGTGATGIDTHPLC
GATCPCR Primer 2GAGAATGTGAGTGAAGATGTATGGTGAIDTHPLC
P5.GATECustom Read 1 Primer -required for sequencing ofamplicons.CGCCGGAGTTGGAGTGAGTGGATGAGTGATGIDTHPLC
GATE*.P5*Custom i5 index primer -required for some Illuminasequencers (see caption).CATCACTCATCCACTCACTCCAACTCCGGCGIDTHPLC
S502.GATEPrimer for library prep - i5 (barcode) side.AATGATACGGCGACCACCGAGATCTACACCTCTCTATCGCCGGAGTTGGAGTGAGTGGATGAGTGATGIDTHPLC
S503.GATEPrimer for library prep - i5 (barcode) side.AATGATACGGCGACCACCGAGATCTACACTATCCTCTCGCCGGAGTTGGAGTGAGTGGATGAGTGATGIDTHPLC
S505.GATEPrimer for library prep - i5 (barcode) side.AATGATACGGCGACCACCGAGATCTACACGTAAGGAGCGCCGGAGTTGGAGTGAGTGGATGAGTGATGIDTHPLC
S506.GATEPrimer for library prep - i5 (barcode) side.AATGATACGGCGACCACCGAGATCTACACACTGCATACGCCGGAGTTGGAGTGAGTGGATGAGTGATGIDTHPLC
S507.GATEPrimer for library prep - i5 (barcode) side.AATGATACGGCGACCACCGAGATCTACACAAGGAGTACGCCGGAGTTGGAGTGAGTGGATGAGTGATGIDTHPLC
S508.GATEPrimer for library prep - i5 (barcode) side.AATGATACGGCGACCACCGAGATCTACACCTAAGCCTCGCCGGAGTTGGAGTGAGTGGATGAGTGATGIDTHPLC
Next.N701(Normal) primer for library prep - i7 side.CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGIDTHPLC
Next.N702(Normal) primer for library prep - i7 side.CAAGCAGAAGACGGCATACGAGATCTAGTACGGTCTCGTGGGCTCGGIDTHPLC
Next.N703(Normal) primer for library prep - i7 side.CAAGCAGAAGACGGCATACGAGATTTCTGCCTGTCTCGTGGGCTCGGIDTHPLC
Next.N704(Normal) primer for library prep - i7 side.CAAGCAGAAGACGGCATACGAGATGCTCAGGAGTCTCGTGGGCTCGGIDTHPLC
Next.N705(Normal) primer for library prep - i7 side.CAAGCAGAAGACGGCATACGAGATAGGAGTCCGTCTCGTGGGCTCGGIDTHPLC
Next.N706(Normal) primer for library prep - i7 side.CAAGCAGAAGACGGCATACGAGATCATGCCTAGTCTCGTGGGCTCGGIDTHPLC

Protocol Overview
This protocol is for performing Light-Seq in tissue samples, as published in Nature Methods. The typical experiment can be performed by a single scientist in one work week, with natural pause points.

Day 0:
Tissue Dissection & Fixation (~2 hours)

Day 1:
Tissue Sectioning (1 hour)
In Situ Reverse Transcription (2.5 hours)
A-tailing (1 hour)
Antibody Stain (optional, 1-3 hours or overnight)


Day 2:
Light-Directed Barcoding (~4 hours for 3 ROIs and 3-6 replicates)

Day 3:
cDNA Displacement (1 hour)
Cross-Junction Synthesis (2 hours)


Day 4:
qPCR and PCR Amplification (5 hours)


Day 5:
Library Preparation for Next-Generation Sequencing (3 hours)
Before Starting
This protocol is for selective sequencing of cells within fixed tissue sections that have been sectioned on to a coverslip or microscope slide.

Clean workspace (bench, pipettes, etc.) with ethanol before starting. When the protocol calls for water, always use UltraPure water. All reagents should be molecular-grade and RNAse free. All reactions with enzymes are prepared on ice.

Key Equipment:
Microscope
Light-Seq requires an optical system that can focus UV light onto specific regions of interest. In the publication, we employ a wide field microscope with a 365 nm LED and a digital micromirror device (DMD) to accomplish this, but other systems are also amenable. We have also tested a point-scanning confocal microscope with a 405 nm laser. We recommend consulting your microscopy core or representative to discuss the best solution at your institution.

Flat-top Thermocycler
The first few steps of the protocol require thermal cycling and incubations of tissue slides. For this, we recommend the Eppendorf® Mastercycler® nexus Flat Thermal Cyclers (VWR Cat No. 71003-568).



Tissue Dissection and Fixation
Determining tissue-specific fixation/preservation protocol
The protocol outlined here is for cryo-sectioned mouse retinas. Different tissues require different optimizations for fixation and sample preparation. We highly recommend using standard tissue-specific protocols that are compatible with RNA detection (FISH, for example) as a starting point for Light-Seq.

Times for fixation, washing, and incubation will vary for different sample types. In general, we find that over-fixation can greatly impair Light-Seq barcoding efficiency and in some cases, antigen retrieval protocols are required (e.g. for FFPE). It is recommended to minimally but sufficiently fix your tissue and to freeze immediately to preserve RNA quality. As a starting point, we recommend starting with standard tissue-specific protocols that are compatible with in situ RNA FISH.

For users who have not performed FISH in their samples before, we recommend testing the RNA quality in your tissue before proceeding with Light-Seq. This could be done using any number of RNA-detection methods, including HCR, RNA-scope, etc. We expect that tissue preparation parameters that work well for these in situ RNA detection methods should also work well for Light-Seq.
Tissue Fixation and Embedding Reagents
ABC
ReagentsSupplierCat. No.
Triton-X-100Sigma AldrichT8787- 50ML
Pierce™ 16% Formaldehyde (w/v), Methanol-freeThermo Scientific28908
PBS - Phosphate-Buffered Saline (10X) pH 7.4, RNase-freeInvitrogenAM9625
Tissue-Tek® O.C.T. CompoundSakura4583
Sucrose, Molecular Biology GradeThermo ScientificJ65148.A1

Retina dissection, fixation and embedding
  1. Prepare solutions:
4% PFA, 0.25% TritonX-100 in 1X PBS (40 ml):
10 mL 16% PFA ampule
4 mL 10X PBS (molecular-grade)
26 mL nuclease-free water
100 μl Triton-X-100
Note: Buffer should be prepared in fume hood as formaldehyde is toxic. Please prepare this fresh and do not freeze.

30% sucrose in 1X PBS:
15 mg sucrose
in final volume of 50 mL 1X PBS
Note: Filter-sterilize using 0.4 μm filter and store at 4C.

7% sucrose in 1X PBS:
3.5 mg sucrose
in final volume of 50 mL 1X PBS
Note: Filter-sterilize using 0.4 μm filter and store at 4C.

Cryoprotectant Solution:
50 mL of 1:1 mixture of [30% sucrose in 1X PBS] : [Tissue-Tek O.C.T. Compound]
Note: This mixture will take time to mix thoroughly. Vortexing will help, but be sure to spin it down after to remove bubbles before applying to the tissue.

2. Dissect mouse retinas in 1X PBS at room temperature.
3. Immediately transfer retinas to 4% PFA, 0.25% TritonX-100 in 1X PBS for 25 mins at room temperature, rocking.
4. Wash 3 x 5 min in 1X PBS.
5. Transfer retinas to 7% sucrose in 1X PBS for 10 min, rocking.
6. Transfer retinas to Cryoprotectant Solution for 30 min rocking, to equilibrate the tissue in cryoprotectant before freezing.
7. Transfer retinas to cryomolds and freeze in Cryoprotectant Solution.
8. Store frozen retinas at -80C for up to 6 months (possibly longer, but not tested).

Tissue Sectioning and Reverse Transcription
Recommended to section onto a coverslip
For Light-Seq, it is critical that light can be focused onto the cells of interest. Thus, there should be minimal disruption of the light-path from the microscope to the sample during barcoding. This is very important for labelling isolated cells within a tightly packed tissue, where barcoding boundaries must be precise. In the publication, we sectioned retinas into chambers on glass coverslips coated with poly-D-lysine to promote tissue adhesion (Ibidi, #80826). We recommend sectioning onto coverslips if possible, and either using the Ibidi chambers or a chamber that sticks onto the coverslips (GraceBio Labs SecureSeal™ Hybridization Chambers https://gracebio.com/product/secureseal-hybridization-chambers-621102/). These come in a variety of sizes and allow multiple tissue sections to be treated separately on the same coverslip. For these, it is important to cover the holes during extended incubations to prevent evaporation (e.g. with a coverslip or a sticker).

Some tissues do not adhere well to coverslips. If problems occur with tissue adhesion, we recommend coating the coverslip prior to sectioning with a poly-D-lysine solution or some other polymer, baking the sample after sectioning, or sectioning onto SuperFrost Plus slides.


For sections on thick microscope slides
It is possible to perform barcoding on tissue sections that are on SuperFrost Plus Adhesion Slides (Thermo Scientific, #J1800AMNZ). We have found that SuperFrost Plus slides promote better tissue adhesion than coated coverslips. In this case, we recommend using the Grace Bio-Labs SecureSeal Chambers for easy fluid exchanges and to prevent evaporation. However, please note that if barcoding is performed through a thick glass slide then there will be refraction of light through the glass, which can create imprecise barcoding. This is not an issue for barcoding of large regions where the boundaries need not be precise, but for boundary cases where precision of <10 um in the XY-dimension is critical, we do not recommend barcoding through thick slides.
Cryosectioning and Reverse Transcription
Sectioning for Light-Seq is ideally performed on a coverslip, to promote optimal light delivery for photocrosslinking of DNA barcodes. In situ reverse transcription (RT) is performed to create cDNA copies of all RNA within the fixed tissue sections and is done using a thermocycler for slides, rather than tubes. We recommend the Eppendorf® Mastercycler® nexus Flat Thermal Cyclers (VWR Cat No. 71003-568).

Reverse transcription is performed in situ using random primers (5N3G) with a barcode docking site on a 5' overhang. This dock site enables selective cDNA barcoding via photocrosslinking in downstream steps.
Reagents for Sectioning
ABC
ReagentsSupplierCat. No.
Option 1: µ-Slide 8 Well, Poly-L-Lysine coatedibidi80826
Option 2, Component 1: Grace Bio-Labs SecureSeal Hybridization ChambersGrace Bio-Labs621102
Option 2, Component 2: LabScientific Rectangular Coverslips, 24 x 50 mm, #1.5, 60 packFisher ScientificLabScientific 7816
TWEEN® 20Sigma AldrichP9416- 50ML
PBS - Phosphate-Buffered Saline (10X) pH 7.4, RNase-freeInvitrogenAM9625
20X Borate BufferThermo Fisher28341
Poly-D-lysine hydrobromideMillipore SigmaP6407-5MG
UltraPure WaterInvitrogen10977023
We recommend either sectioning into an Ibidi chamber (Option 1), or sectioning onto a coverslip with a Grace Bio-Labs chamber on it (Option 2, two components).


Reagents for Reverse Transcription
ABC
ReagentsSupplierCat. No.
Thermo Scientific™ Maxima H Minus Reverse Transcriptase (200 U/μL) (includes 5X buffer)Thermo ScientificFEREP0753
Triton-X-100Sigma AldrichT8787- 50ML
5M NaClInvitrogenAM9760G
TWEEN® 20Sigma AldrichP9416- 50ML
PBSInvitrogenAM9625
FormamideInvitrogenAM9342
UltraPure WaterInvitrogen10977023
Deoxynucleotide (dNTP) Solution Mix - 8 μmol at 10mM eachNEBN0447S
RNaseOUT™ Recombinant Ribonuclease InhibitorInvitrogen10777019

Reverse Transcription DNA Oligos
ABCDE
NameDescriptionSequenceSupplierPurification
RT.5N.3GRT PrimerTTTACACGATTGAGTTATNNNNNGGGIDTHPLC
Recommended to dilute this primer to a 10 uM stock.

Section and perform in situ reverse transcription
  1. Prepare solutions:
1X PBS (40 mL):
4 mL 10X PBS
36 mL UltraPure water

0.1% PBS-Tw (30 mL):
30 mL 1X PBS
30 μL Tween-20

PDL Solution
0.3 mg/mL poly-D-lysine dissolved in 2X Borate Buffer
Note: Store in aliquots at -20C. Do not freeze-thaw.

Stringent Wash (0.1% PBS-Tw + 60% formamide):
3 mL 10X PBS
18 mL 100% formamide
9 mL UltraPure H2O
30 μL Tween-20
Note: Store at 4C for use later during barcoding.

High-Salt Wash (1X PBS + 1 M NaCl + 0.1% Tween- 20):
4 mL 10X PBS
8 mL 5 M NaCl
28 mL UltraPure H2O
40 μL Tween-20
Note: Store at room temperature for use later during barcoding.

10% Triton X-100 (100 μl):
10 μL Triton X-100
90 μL UltraPure water
Note: Mix very well by vortexing. Recommended to make this in a 2 mL tube for better mixing.

2. Coat coverslip with PDL.
- For Ibidi Chambers: Pipette PDL Solution onto the coverslip and let sit for 2 hours or overnight at 4C. Then remove PDL Solution, allow slide to dry completely, and wash once with UltraPure water.
- For SuperFrost slides or coverslips: Pipette 500 μL of PDL Solution onto the slide and let it sit for 1min. Then remove all liquid, allow slide to dry completely, and wash once with UltraPure water.

3. Trace locations of Grace BioLabs Chambers on the back of the coverslip to guide section placement.
4. Prepare Reverse Transcription Master Mix (RTMM) on ice, leaving out enzymes (Maxima RT H minus and RNAse Out). Enzymes will be added directly before RT.

Reverse Transcription Master Mix (RTMM)
ABC
ReagentReaction concentrationμL reagent per 50μL reaction
5X RT buffer1x10
10 mM dNTPs300 μM1.5
UltraPure water26
10% Triton X-1000.5%2.5
10 μM RT.5N.3G primer1 μM5
100 mM RnaseOUT6 mM3
Maxima RT H Minus (200 U/uL)8 U/μL2
Total50
Note: Leave out RnasaOUT and Maxima RT H Minus until Step 13.

5. Section tissue on a cryostat, thickness of 5-18 μm.
6. Once all sections are on the coverslip, bring to room temperature.
7. Immediately spin the coverslip in a plate-centrifuge at 600g for 3 min to promote tissue adhesion.
8. Allow sections to dry completely at room temperature (~10min, time depends on section thickness).
9. Wash sections 3 x 1 min with 1X PBS to fully remove cryoprotectant.
10. Allow coverslip to dry completely between sections (use aspirator or Kimwipe).
11. Adhere Grace BioLabs Chambers to coverslip.
12. Wash sections 3 x 1 min with 0.1% PBSTw.
13. Add enzymes (Maxima RT H minus and RNAse Out) to RTMM and mix well.
14. Remove 0.1% PBSTw and add 50 ul of RTMM to each well.
15. Place slide into Eppendorf® Mastercycler® nexus Flat and run RT program (2h 20 min). Place a second coverslip over the chambers to prevent evaporation.

Reverse Transcription Thermocycler Program
12-cycle ramp program (Lid: 60°C):
Phase 1:
22°C 30 mins
Phase 2 (12 cycles):
8°C 30 s
15°C 30 s
25°C 30 s
30°C 1 min
37°C 1 min
42°C 2 min
Phase 3:
42°C 30 min
4°C Forever
16. Wash each well 3 x 5 min in Stringent Wash.
17. Wash each well 2 x 2 min in High Salt Wash.
18. Wash each well 2 x 2 min in 0.1% PBS-Tw.
19. Fill each well with 50 ul of 0.1% PBS-Tw.

Optional Pause Point: Store at 4C overnight before A-tailing.

NOTE: Sectioning for the publication was done immediately before reverse transcription. It is possible, however, to section and immediately freeze the sections at -80C. If using frozen sections, start from step (8) above, and allow sections to dry completely after thawing. To preserve RNA quality, the time between section thawing and RT should be minimal.
After in situ RT, A-tailing is performed to add a polyA tail to the 3’ end of newly transcribed cDNAs, providing a handle on the 3’ end for downstream amplification. The A-tailing reaction is isothermal at 37C, and can be performed in a flat-top thermocycler or in a hybridization oven. Once cDNAs are A-tailed, immunofluorescent staining can optionally be performed to identify cells before barcoding.

A-tailing Reagents
ABC
ReagentsSupplierCat. No.
Deoxynucleotide (dNTP) Solution Set- 25 μmol each at 100 mM (just need dATP)NEBN0446S
2′,3′-Dideoxyadenosine 5′-Triphosphate, 100 mM solution (ddATP)Sigma AldrichGE27-2051-01
Terminal Transferase Enzyme (TdT) - 2,500 unitsNEBM0315L
ThermoPol® Reaction Buffer PackNEBB9004S
TWEEN® 20Sigma AldrichP9416- 50ML
10X PBSInvitrogenAM9625
Perform A-tailing, in situ
1. Create aliquots of 10 mM dATP (20 µL aliquots) and 25 mM ddATP (~3 µL aliquots). Store at -20C.
2. Dilute ddATP stock to 250 μM (1:100 dilution from 25 mM stock).
3. Create A-tailing Master Mix on ice:
ABC
ReagentReaction concentrationuL reagent per 50uL reaction
10X ThermoPol Reaction Buffer1X5
10 mM dATP1 mM5
250 μM ddATP25 μM5
Ultrapure water32.5
TdT enzyme (20,000U/mL)1000 U/mL2.5
Total50

4. Wash wells once with 0.1% PBS-Tw. 5. Aspirate, add 50 μL A-tailing Master Mix and incubate for 45min at 37C. If using Grace Bio-Labs chambers, be sure to cover the holes with a coverslip or stickers to prevent evaporation.
6. Wash 3 x 1min in 0.1% PBS-Tw.

Optional Pause Point: Store at 4C overnight before barcoding.
Step case

Optional Pre-Barcoding Immunofluorescent Staining
8 steps

If you want to perform immunofluoresence to aid in cell/ROI selection for barcoding, this should be done after A-tailing and before barcoding.

IMPORTANT: Do not use normal blocking serum, as it may contain enzymes that can destroy the RNA and dislodge cDNAs from the sample. Be sure to use molecular grade reagents for blocking.

IMPORTANT: If you will use this stain to visualize your ROI during barcoding (when barcode strands are hybridized to the docking sites on cDNAs within sample), do NOT use a stain that requires UV illumination for imaging, as imaging this stain will induce photocrosslinking of the barcodes onto cDNAs in your sample. We recommend using Red or Far-Red channels for pre-barcoding stains.


1. Make RNase-free Blocking Solution.
RNase-free Blocking Solution for Antibody Staining (1% BSA in PBS-Tween)
1 mL 10% (weight to volume) molecular grade recombinant BSA
10 µL 100% Tween-20
1 mL 10X PBS
8 mL UltraPure water
2. Add 50 µL of Blocking Solution to each well. Incubate for 30 min to 1 hr at room temperature.
3. Add 50 µL primary antibody at desired dilution, diluted in block. Wash with 0.1% PBS-Tw 3 x 5 minutes.
4. Add 50 µL secondary antibody at desired dilution, diluted in block. Wash 3 x 5 minutes with 0.1% PBS-Tw.
* DO NOT USE UV-CHANNEL FOR STAINS *!
5. Proceed to barcoding.


Light-Directed Barcoding of cDNAs
Choosing an Optical System
Before starting, ensure that your optical system is set up and calibrated properly, so that UV light can be focused on cells/regions of interest (ROIs).
Light-Directed Barcoding of Select Cells for Sequencing
Light-directed barcoding is performed sequentially for different regions of interest/cell populations within the same sample. For sequencing three regions, three rounds of barcoding are performed with a unique barcode sequence used in each round. The three barcodes used in the publication are listed in the table below, and in Supplementary Table 6.

The [cnvK] modification forms a crosslink to the opposing DNA strand upon hybridization to a complementary sequence and illumination with UV light (365 nm optimal). In this way, the barcoding of cDNAs within a sample can be spatially restricted using a microscope, by targeting UV illumination to regions of interest while the barcode strand is hybridized to the dock sites that were introduced on the reverse transcription primers.
Light-Seq Barcode Sequences
ABCDE
Sequence name Purpose Sequence SupplierPurification
GATE.D12.B1 Barcode sequence 1 - Cy5 labeled barcode strand. GGAGTTGGAGTGAGTGGATGAGTGATGDDDDDDDDDDDDTATGGATGAGTTATATAACTCA[cnvK]TCGTGTAAAT[Cy5-3] GeneLinkPAGE
GATE.D12.B2 Barcode sequence 2 - Cy3 labeled barcode strand. GGAGTTGGAGTGAGTGGATGAGTGATGDDDDDDDDDDDDGTTAGGTGAGTTATATAACTCA[cnvK]TCGTGTAAAT[Cy3-3] GeneLinkPAGE
GATE.D12.B3 Barcode sequence 3 -Fluorescein (FITC) labeled barcode strand. GGAGTTGGAGTGAGTGGATGAGTGATGDDDDDDDDDDDDAGGGTATGAGTTATATAACTCA[cnvK]TCGTGTAAAT[Fl-3] GeneLinkPAGE
Note: Fluorescently labelled barcode strands are light-sensitive and should be protected from light when possible, although some ambient light is acceptable. We routinely do all steps in well-lit rooms, but cover the samples and tubes with foil during incubation periods. A Barcoding Master Mix is made (with excess) on the day-of and kept at room temperature, containing all barcoding reagents with the exception of the barcode strands (GATE.D12.B[0-2]) and Salmon Sperm DNA.

Barcoding Reagents
ABC
ReagentsSupplierCat. No.
Dextran Sulfate 50% SolutionSigma AldrichS4030
Salmon-sperm DNAThermo FisherAM9680
5 M NaClInvitrogenAM9760G
TWEEN® 20Sigma AldrichP9416- 50ML
PBSInvitrogenAM9625
FormamideInvitrogenAM9342
UltraPure WaterInvitrogen10977023
Barcode DNA Oligos (see sequences table)GeneLink

Light-Directed Barcoding of cDNAs
1. Prepare barcoding solutions:
Stringent 60% Wash (0.1% PBS-Tw + 60% formamide):
4 mL 10X PBS
24 mL 100% formamide
12 mL UltraPure H2O
40 μL Tween-20
Note: Store at 4C for use later during barcoding.

High-Salt Wash (1X PBS + 1 M NaCl + 0.1% Tween- 20):
4 mL 10X PBS
8 mL 5 M NaCl
28 mL UltraPure H2O
40 μL Tween-20
Note: Store at room temperature for use later during barcoding.

Hybridization Master Mix
ABC
ReagentReaction concentrationμL per 50 μL well**
10X PBS1x5
5M NaCl500 mM5
UltraPure water18.7
Dextran Sulfate 50% solution10%10
10 mg/mL sheared salmon sperm DNA2 mg/mL10
TWEEN® 200.1%0.05
Total48.75
** Dextran sulfate makes this mix viscous, so it is recommended to make significant excess (~1.2X what is needed for the number of wells).

2. Add barcoding strands to Hybridization Master Mix to create Barcoding Solutions:

Barcode 0 Solution (per 50 uL well - make excess!):
1.25 μL of 10 µM Barcode Strand (GATE.D12.B0)
48.75 μL hybridization master mix

Barcode 1 Solution (per 50 uL well - make excess!):
1.25 μL of 10uM Barcode Strand (GATE.D12.B1)
48.75 μL hybridization master mix

Barcode 2 Solution (per 50 uL well - make excess!):
1.25 μL of 10uM Barcode Strand (GATE.D12.B2)
48.75 μL hybridization master mix

3. Replace liquid in each well with High-Salt Wash.
4. Aspirate to remove all liquid, add Barcode 0 Solution. Incubate for 30 min at room temperature to allow barcodes to hybridize to cDNA 5' overhangs. Cover slide with foil to protect from light.
5. Aspirate to remove all liquid, then wash 3 x 1 min in High-Salt Wash.
6. Replenish the well with High Salt Wash. Ensure that the sample is completely covered in liquid.
7. Bring sample to the microscope to perform imaging and light-directed barcoding. Use bright-field or histological stain to visualize cells/region of interest. Be sure to avoid using the UV channel for imaging stains, as this will induce off-target photo-crosslinking of barcodes outside of the region of interest.
Note: If evaporation occurs during barcoding, add more High Salt Wash.
8. Perform light-directed barcoding.
GFP+ HEK cells were co-cultured with mouse 3T3 cells and the two cell populations were barcoded in two successive rounds of barcoding. Screenshot of the Nikon Elements software with GFP image overlaid with bright field and with ROIs outlined around GFP+ cells. In this case, cells were manually outlined in the Nikon Elements Software using the Bezier ROI tool.
9. Remove slide from microscope and wash 8 times consecutively in Stringent 60% Wash.
Note: For applications where very few cells are targeted (<50 cells), increasing the number of stringent washes will likely help reduce background. We recommend up to doubling the number of stringent washes after each round of barcoding.
10. Wash 2 x 2 min in High-Salt Wash, then add fresh High-Salt Wash.
11. For additional barcoding rounds to sequence additional cell populations, repeat steps 3-10 with Barcode 1 Solution and Barcode 2 Solution.

Screenshot of the Nikon Elements software with GFP image overlaid with bright field and with ROIs outlined around GFP- 3T3 cells. In this case, cells were manually outlined in the Nikon Elements Software using the Bezier ROI tool.
12. Transfer to 0.1% PBS-Tween and optionally image barcoded cDNAs to visualize.

Optional Pause Point : Store at 4C overnight in a humidified chamber. If using Grace Bio-Labs chambers, be sure to cover the holes with a coverslip or stickers to prevent evaporation.

Note
Note: The fluorescent barcode strands photo-bleach quickly and may appear dim even if barcoding worked well. Acquisition settings similar to those used for smFISH visualization are recommended as a starting point. At this point, DAPI and WGA can be added, and the 405 nm channel can be used for staining and imaging.
These images are from the experiment comparing transcriptomes of cellular layers in the mouse retina in the Light-Seq publication. Three distinct cellular layers in 18 um cryosections were barcoded with 3 rounds of light-directed barcoding. (a) ROIs selected for barcoding based on bright-field image were converted to a binary TIFF mask by the microscope software (Nikon Elements). (b) Post-barcoding, retinas were stained with DAPI and the fluorescent barcodes were imaged on a spinning-disk confocal microscope.
Displacement of cDNAs
Now that cDNAs are barcoded and A-tailed, they must be extracted for library preparation and sequencing. To do this, the RNA template is digested by mild RNaseH treatment, which degrades the RNA bound to the barcoded cDNAs in situ, liberating the barcoded cDNAs for collection.

Note: Use low retention tips.


The displaced barcoded-cDNAs contain a photocrosslink, preventing normal amplification by PCR. Therefore, the Cross-Junction Synthesis reaction creates a single stitched product strand containing the DNA barcode and the cDNA sequence, producing a single amplifiable strand for library preparation and sequencing.



Displacement Reagents
ABC
ReagentsSupplierCat. No.
ThermoPol® Reaction Buffer PackNEBB9004S
RNase H - 1,250 unitsNEBM0297L
UltraPure WaterInvitrogen10977023

Cross-Junction Synthesis Reagents
ABC
ReagentsSupplierCat. No.
Bst DNA Polymerase, Large Fragment- 8,000 unitsNEBM0275L
ThermoPol® Reaction Buffer PackNEBB9004S
UltraPure WaterInvitrogen10977023
Deoxynucleotide (dNTP) Solution Mix - 8 μmol at 10mM eachNEBN0447S
Cross-Junction Synthesis Primer
ABCDE
NameDescriptionSequenceSupplierPurification
GATC.20T.pPrimer for Cross-Junction SynthesisGAGAATGTGAGTGAAGATGTATGGTGATTTTTTTTTTTTTTTTTTTTIDTHPLC

Displace and collect cDNAs separately for each well
1. Dilute cross-junction synthesis primer GATC.20T.p in UltraPure water to make 1 uM stock.
5 µL 10 µM primer (GATC.20T.p)
45 µL UltraPure water
2. Make Displacement Mix.
ABC
ReagentReaction concentrationuL reagent per 50 uL well
10x ThermoPol Reaction Buffer1x5 μL
RNase H (from NEB) (5,000U/mL)250 U/mL2.5 μL
UltraPure Water42.5 µL
Total50
3. Aspirate liquid from wells and add 50 μL of Displacement Mix to each well.
4. Cover the well holes with a drop of Mineral Oil and incubate at 37C for 45min.
NOTE: If using Grace Bio-Labs chambers, we recommend Mineral Oil to minimize loss of solution during displacement.
5. While samples are incubating, prepare a separate collection tube for each well by adding 1.2 μL of 1 μM primer (GATC.20T.p) to a low bind PCR tube.
6. After the incubation, pipette well solution up and down 5-7 times in the well without creating bubbles.
7. Collect all liquid from the well in the corresponding collection tube, prepared in Step 5. Repeat for all wells using fresh tips for each.
8. Wash wells 3 times with 0.1% PBS-Tw. Move to 4C in a humidified chamber for storage, ensuring the wells are covered to prevent evaporation.
9. Heat inactivate the collection tubes in a thermocycler at 75C for 20min.
10. Move tubes to ice and proceed to Cross-Junction Synthesis.

Optional: Samples can be imaged after displacement to verify that the fluorescent barcode signal is no longer present. At this point, follow-up stains can be performed on the sample including antibody stains, H&E, etc.

Comparison of tissue before and after displacement. The fluorescent barcode strands should be largely removed upon displacement. In some tissues/cases, the displacement may not be this efficient. It is possible to get some fluorescent barcode strands stuck within the sample.


Cross-Junction Synthesis
1. Add 8.16 μL Cross-Junction Synthesis Mix to each tube:
ABC
ReagentFinal Reaction concentrationuL reagent per 50 uL well
10X ThermoPol buffer1x0.92
10mM dNTPs100 μM0.59
Ultrapure water0.85
Bst LF polymerase (8,000U/mL)800U/mL5.8
Total8.16
Note: These volumes are for 50 uL wells, and volumes should be scaled according to well volume. Note that the primer (GATC.20T.p) was added in the previous step, before heat inactivation.
2. Vortex and spin briefly.
3. Incubate in a thermocycler for:
37C for 30 mins
80C for 20 mins
4. The resulting products are CJS Samples. Proceed to qPCR to amplify CJS Samples.

Optional Pause Point : Store at -20C overnight.
qPCR Amplification
Cross-Junction Synthesis libraries of barcoded cDNAs are now amplified and prepared for sequencing. We use the Kapa Hifi HotStart polymerase. We recommend performing qPCR with 30 cycles on a small subset of each sample (5 uL sample in a 10 uL PCR), to identify the appropriate cycle number for optimal amplification.

qPCR Primers
ABCDE
NameDescriptionSequenceSupplierPurification
GATEPCR Primer 1GGAGTTGGAGTGAGTGGATGAGTGATGIDTHPLC
GATCPCR Primer 2GAGAATGTGAGTGAAGATGTATGGTGAIDTHPLC
Reagents for qPCR
ABC
ReagentsSupplierCat. No.
SYBR™ Green I Nucleic Acid Gel Stain - 10,000X concentrate in DMSOInvitrogenS7563
HiFi HotStart DNA Polymerase, KapaBiosystemsRocheKK2502
UltraPure WaterInvitrogen10977023

qPCR to Determine Amplification Cycle Number
1. Vortex CJS Samples.
2. Dilute Sybr Green I dye in water to make 5x solution (e.g. dilute 10,000X stock twice, 1:100 in water, then 1:20 in water).
3. Create PCR master mix:
AB
Kapa qPCR Master Mix
ReagentµL reagent per 10 µL reaction
5x SYBR Green I1
Kapa HiFi HotStart buffer (5x)2
10 µM GATE primer0.3
10 µM GATC primer0.3
10 mM dNTPs from Kapa kit0.3
UltraPure water0.9
Kapa HiFi Hot Start polymerase0.2
Total5
The ratio of Kapa qPCR Master Mix to Cross-Junction Synthesis Solution is 1:1, so each sample will have a 10 uL total PCR with 5 uL of Kapa qPCR Master Mix and 5 uL of Cross-Junction Synthesis Solution.

4. Quickly vortex and spin down master mix, then add 5 uL master mix into each tube.
5. Add 5 uL of appropriate sample from Cross-Junction Synthesis reaction to each tube.
6. Quickly vortex and spin down reactions.
7. Place into qPCR machine for 30 cycles and run the qPCR Machine Protocol.
qPCR Machine Protocol
98C for 3 minutes
30 cycles of:
98C for 20 seconds
60C for 30 seconds
72C for 2 minutes
Plate read
72C for 5 minutes
Melting curve analysis
Hold at 4C
8. Check amplification graph to choose appropriate cycle number.
Note
NOTE: Cycle number for amplification of the remaining Cross-Junction Synthesis Product should be chosen to prevent over-amplification of the library. In general, the optimal cycle number will correlate with the size of the barcoded region, which directly impacts how much amplifiable cDNA exists within the reaction. Note that for technical replicates, the amplification curves are generally very consistent. In general, optimal cycle number will vary across experiments and we recommend that the full PCR is run at the optimal cycle number per experiment.

2h
After the test qPCR on a small amount of sample, a PCR is performed on all of the CJS Samples to amplify the entire sample for library preparation and sequencing. The cycle number for amplification is chosen based on the test qPCR in the previous step, to prevent over-amplification. Each Cross-Junction Synthesis product (1 per sample well) is amplified in a separate tube. This protocol is identical to the prior qPCR, but scaled to amplify the entire sample and with a reduced number of cycles.

All of the sample should be amplified. However, most qPCR machines have a limit of 50 uL/reaction. Therefore, the full volume should be split into multiple PCRs to ensure accurate amplification.

Amplification of Full Samples
1. Briefly vortex and spin CJS Samples.
2. Measure the volume of CJS sample in each tube and use to calculate volume of qPCR master mix needed for each sample (1:1 ratio of qPCR master mix : CJS sample).
Note: Ensure that PCR volumes do not exceed the limits for your machine and otherwise, split into multiple tubes.
3. Dilute Sybr Green I dye in water to make 5x solution (e.g. dilute 10,000X stock twice, 1:100 in water, then 1:20 in water).
4. Create qPCR master mix:
AB
Kapa Full qPCR Master Mix
ReagentµL reagent per 50 µL reaction
5x SYBR Green I10
Kapa HiFi HotStart buffer (5x)20
10 µM GATE primer3
10 µM GATC primer3
10 mM dNTPs from Kapa kit3
Ultrapure water9
Kapa HiFi hot start polymerase2
Total50
The ratio of Kapa qPCR Master Mix to Cross-Junction Synthesis Solution is 1:1, so each sample will have a 10 µL total PCR with X µL of Kapa qPCR Master Mix and X µL of Cross-Junction Synthesis Solution.
5. Add the entire remaining sample with equal parts master mix to each tube.
6. Quickly vortex and spin down reactions.
7. Place into qPCR machine for exactly XX cycles and run the Full qPCR Machine Thermocycler Program.
Full qPCR Machine Thermocycler Program
98C for 3 minutes
XX cycles of:
98C for 20 seconds
60C for 30 seconds
72C for 2 minutes
Plate read
72C for 5 minutes
Hold at 4C
*XX is based on the amplification curves from the test qPCR. This number will likely range between 16 and 25.
8. The resulting products are Amplified Samples.
2h
Library Preparation for Illumina Sequencing
5h
Light-Seq uses conventional tagmentation-based library preparation for Illumina sequencing, but with custom primers for the secondary PCR and for Read 1/i5 sequencing. The custom primers are necessary to specifically enrich for and sequence amplicons containing the light-directed barcode sequences. The first step is bead purification of the amplified libraries for each well, followed by tagmentation, secondary PCR amplification, and a second bead purification.

Library Preparation Reagents
ABC
ReagentsSupplierCat. No.
Magnetic Separator (or equivalent)10X Genomics120250
Ampure XP BeadsBeckmanA63881
Ethyl alcohol, pure (200 proof)Sigma AldrichE7023-1L
Qubit™ 1X dsDNA High Sensitivity (HS) and Broad Range (BR) Assay KitsInvitrogenQ33231
Nextera XT Library Preparation KitIlluminaFC-131-1096
UltraPure WaterInvitrogen10977023
Library Preparation DNA Oligos
These primer sequences are used for unique indexing of samples for pooled sequencing. For each sample, a unique pair of S50X and Next.N70X are required. You do not need to order all primers, only enough pairs to uniquely index your samples of interest. Because the custom i5 index primer does not work well on all Illumina machines, we highly recommend each sample be prepared with a unique i7 index. We hope to adjust our recommendations on this front soon, so stay tuned for updated protocols.
ABCDE
NameDescriptionSequenceSupplierPurification
S502.GATEPrimer for library prep - i5 (barcode) side.AATGATACGGCGACCACCGAGATCTACACCTCTCTATCGCCGGAGTTGGAGTGAGTGGATGAGTGATGIDTHPLC
S503.GATEPrimer for library prep - i5 (barcode) side.AATGATACGGCGACCACCGAGATCTACACTATCCTCTCGCCGGAGTTGGAGTGAGTGGATGAGTGATGIDTHPLC
S505.GATEPrimer for library prep - i5 (barcode) side.AATGATACGGCGACCACCGAGATCTACACGTAAGGAGCGCCGGAGTTGGAGTGAGTGGATGAGTGATGIDTHPLC
S506.GATEPrimer for library prep - i5 (barcode) side.AATGATACGGCGACCACCGAGATCTACACACTGCATACGCCGGAGTTGGAGTGAGTGGATGAGTGATGIDTHPLC
S507.GATEPrimer for library prep - i5 (barcode) side.AATGATACGGCGACCACCGAGATCTACACAAGGAGTACGCCGGAGTTGGAGTGAGTGGATGAGTGATGIDTHPLC
S508.GATEPrimer for library prep - i5 (barcode) side.AATGATACGGCGACCACCGAGATCTACACCTAAGCCTCGCCGGAGTTGGAGTGAGTGGATGAGTGATGIDTHPLC
Next.N701(Normal) primer for library prep - i7 side.CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGIDTHPLC
Next.N702(Normal) primer for library prep - i7 side.CAAGCAGAAGACGGCATACGAGATCTAGTACGGTCTCGTGGGCTCGGIDTHPLC
Next.N703(Normal) primer for library prep - i7 side.CAAGCAGAAGACGGCATACGAGATTTCTGCCTGTCTCGTGGGCTCGGIDTHPLC
Next.N704(Normal) primer for library prep - i7 side.CAAGCAGAAGACGGCATACGAGATGCTCAGGAGTCTCGTGGGCTCGGIDTHPLC
Next.N705(Normal) primer for library prep - i7 side.CAAGCAGAAGACGGCATACGAGATAGGAGTCCGTCTCGTGGGCTCGGIDTHPLC
Next.N706(Normal) primer for library prep - i7 side.CAAGCAGAAGACGGCATACGAGATCATGCCTAGTCTCGTGGGCTCGGIDTHPLC

Bead purification of Amplified Samples
NOTE: Each well/replicate is processed separately .
  1. Make 50 mL of 80% Ethanol, diluted in UltraPure water.
  2. For each well, combine 80 µL Amplified Sample with 96 µL Ampure XP Beads in a new PCR tube.
  3. Mix well by pipetting (incubate at room temperature for 5 min). DO NOT overextend this step.
  4. Place on Magnetic Separator Stand for 2 min.
  5. Discard supernatant. Wash 3 x 30 sec with 200 µL of 80% Ethanol.
  6. Discard ethanol and aspirate remainder with a small 10 µL tip.
  7. Air dry for ~5 min, until beads are dry. Beads will change color slightly when dry.
  8. Add 30 µL of water to resuspend the beads.
  9. Remove from the magnetic stand. Mix well by pipetting or vortexing and incubate for 2 min at room temperature.
  10. Place Magnetic Separator Stand for 1 min. Collect supernatants in new PCR tubes. These are Purified Amplified Samples.


Measure DNA concentrations of Amplified Samples with Qubit HS dsDNA assay
This should be done according to the manufacturer's instructions, found here: https://assets.fishersci.com/TFS-Assets/LSG/manuals/MAN0017455_Qubit_1X_dsDNA_HS_Assay_Kit_UG.pdf.

1. Measure concentrations using Qubit Fluorometer.
2. Record concentrations of each Purified Amplified Sample.


Perform Nextera tagmentation
Reagents in this section are from the Nextera XT Library Preparation Kit (Illumina cat. no. FC-131-1096). Tagmentation will fragment the amplified PCR products into shorter sequences, and the length of the reaction time determines how much fragmentation occurs. Therefore, it is very important to follow the times strictly.
  1. In a clean set of PCR tubes, aliquot 7 µL of Neutralize Tagment Buffer (NT). This will be used to stop the tagmentation and prevent over-tagmentation. One tube per sample/well is required. Set aside, next to the thermocycler.
  2. To a new PCR tube for each Purified Amplified Sample (on ice):
a. Add 10 µL of tagment DNA buffer (TD) b. Add 2 ng of purified Purified Amplified Samples and add water up to 5uL. Calculated sample and water volume to add based on the Qubit concentrations from previous step.
c. Add 5 µL of Amplicon Tagment Mix (ATM) to lid of tube. This contains the enzyme. 3. Briefly spin down tubes, vortex, and spin down. 4. Place into PCR machine and incubate at 55°C for EXACTLY 5 minutes.
5. Immediately stop reactions with 5 µL of Neutralize Tagment buffer (NT) (use a multichannel to mix).
6. Vortex and spin to ensure full mixing. Hold Tagmented Samples on ice.


Sample indexing PCR with unique i5 and i7 primer pairs
To pool Tagmented Samples from each well/replicate for sequencing, each sample is assigned a unique pair of i7 and i5 primer sequences. The primer pairings should be decided and documented. Each Tagmented Sample will be amplified briefly in this step to attached the sample-specific i5 and i7 sequences.

1. Assign and record unique index primer pairs to each sample. For example:
ABC
Samplei5 primeri7 primer
Tagmented Sample 1 (Well 1)S502.GATENext.N701
Tagmented Sample 2 (Well 2)S503.GATENext.N702
Tagmented Sample 3 (Well 3)S505.GATENext.N703
Tagmented Sample 4 (Well 4)S506.GATENext.N704
Each sample will receive a different pair of primers in the indexing PCR.
2. To each Tagmented Sample tube from the previous tagmentation step:
a. Add 6.5 µL water b. Add 1.75 µL of standard Nextera (i7: Next.N70X) primer (from 10 uM stock) c. Add 1.75 µL of custom Nextera (GATE, i5: S50X.GATE) primer (from 10 uM stock)
d. Add 15 µL PCR mix (NPM PCR master mix)
3. Vortex and spin down reactions. 4. Place in thermocycler and start Indexing PCR Program.
Indexing PCR Program
72°C for 3 minutes
95°C for 15 seconds
12 cycles of:
95°C for 15 seconds
55°C for 15 seconds
72°C for 40 seconds
72°C for 1 minute
Hold at 10°C
5. The resulting tubes are the Indexed Samples.


Purify indexed samples with Ampure Beads
  1. Make 50 mL of 80% Ethanol, diluted in UltraPure water.
  2. For each well, combine 50 µL of Indexed Sample and mix with 45 µL Ampure XP Beads in a new PCR tube.
  3. Mix well by pipetting (incubate at room temperature for 5 min). DO NOT overextend this step.
  4. Place on Magnetic Separator Stand for 2 min.
  5. Discard supernatant. Wash 3 x 30 sec with 200 µL of 80% Ethanol.
  6. Discard ethanol and aspirate remainder with a small 10 µL tip.
  7. Air dry for ~5 min, until beads are dry. Beads will change color slightly when dry.
  8. Add 30 µL of water to resuspend the beads.
  9. Remove from the magnetic stand. Mix well by pipetting or vortexing and incubate for 2 min at room temperature.
  10. Place on Magnetic Separator Stand for 1 min.
  11. Collect supernatants in new tubes. These are the Purified Indexed Samples.


Measure DNA concentrations and length of Indexed Samples
1. Measure concentrations using Qubit HS dsDNA assay. This should be done according to the manufacturer's instructions, found here: https://assets.fishersci.com/TFS-Assets/LSG/manuals/MAN0017455_Qubit_1X_dsDNA_HS_Assay_Kit_UG.pdf.
2. Record concentrations of each Purified Indexed Sample.
3. Run 2 uL of each Purified Indexed Sample on a 1% agarose gel.
Sequencing
This library preparation is compatible with standard Illumina next-generation sequencing. Note that custom Read 1 and i5 index primers are required and are listed in the table below.

DNA Oligos for Sequencing
ABCD
DescriptionSequenceSupplierPurification
Custom Read 1 Primer -required for sequencing ofamplicons.CGCCGGAGTTGGAGTGAGTGGATGAGTGATGIDTHPLC
Custom i5 index primer -required for some Illuminasequencers (see caption).CATCACTCATCCACTCACTCCAACTCCGGCGIDTHPLC
We note that the custom index primer is compatible with HiSeq, but for NovaSeq, unique i7 indices were needed for de-convolution due to inefficient i5 index sequencing.
We have found adding 60% above the standard concentration of each custom primer works well on many of the Illumina sequencers and would recommend this as a starting point.

We have had good success with elevated custom primer concentrations on Illumina MiSeq and NextSeq machines. The standard custom primer concentrations worked for HiSeq. For NovaSeq, we haven't seen as good efficiency even with the elevated custom primer concentrations, particularly for the custom i5 index sequencing but hope to have updated recommendations soon. For now, we recommend having unique i7 index sequences for each sample to aid in sequence de-multiplexing, and that you check back here periodically or reach out for updated sequencer-specific recommendations.
Post-Sequencing Tissue Staining
Tissue can stored for 2+ weeks in 1X PBS and can be stained after sequencing. You should cover the sample appropriately to ensure that it does not dry out. We recommend also using a hybridization chamber, and replensihing the liquid in the wells every few days. While some antigens might be disrupted by the protocol, we have detected proteins via immunofluorescence with success in addition to other stains.

Stains for genomic DNA (DAPI), cell membranes (WGA), and two retinal proteins (PAX6 and VSX2) were detected after sequencing. This image was from one of the tissue sections sequenced in the cellular layers experiment from the Light-Seq paper.