Apr 26, 2026
LifePool® Barcoding Workflow - Slime Molds (Myxomycetes)
- Stephen Russell1,2,3
- 1Mycota Lab;
- 2MycoMap;
- 3Biodiverse
- Mycota Lab
Protocol Citation: Stephen Russell 2026. LifePool® Barcoding Workflow - Slime Molds (Myxomycetes). protocols.io https://dx.doi.org/10.17504/protocols.io.5jyl88386l2w/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: December 11, 2025
Last Modified: April 26, 2026
Protocol Integer ID: 234828
Keywords: myxomycete biodiversity, dna barcode for the specimen, myxomycete, dna barcode, cryptic species complex, slime mold, atypical specimen, microscopy
Abstract
This protocol uses a targeted LifePool® approach focused on the SSU (18S) region to deliver a DNA barcode for the specimen, including all of it's genetic variants and typically associated non-target fungi as well. It works alongside traditional mophological examination, microscopy, and taxonomy, helping to resolve cryptic species complexes, confirm identifications of challenging or atypical specimens, and accurately map myxomycete biodiversity. By securing the SSU barcode, you gain objective, phylogenetically informative data that directly supports your physical identifications.
Materials
DNA Extraction:
Extract-N-Amp Equivalent Fluid - See other protocol
Toothpicks - Any local grocery
Tweezers
Thermocycler
Specimen Collection
Slime molds can be collected via standard methods for Continental MycoBlitz or MycoMap Network protocols. In short:
Photograph the specimen.
Upload the images and metadata to iNaturalist.
Dry the specimen using a dehydrator at under 140F.
Print a label for the specimen and put it in a snack-size Ziplock bag.
Additional notes:
Many species will turn to dust once they are touched or they are very small. Review the collection protocols for small speicmens. it may be best to collect them into a small tube or using a toothpick.
DNA Extraction
All extractions are performed using ENA (Extract-N-Amp equivalent) solution per the following protocol:
Toothpick or tweeze spores/tissue into 8-strip PCR tubes that contain 20 µL of ENA. Drop in the tissue or swirl the toothpick in the ENA.
Spore-heavy specimens can be sampled with a toothpick.
Spores on the end of the toothpick.
Record information about each specimen on an appropriate spreadsheet. Our standard metadata recording sheet follows:
Slime Empty NANOPORE TEMPLATE.xlsx113.3KB Add a 1mm stainless steel bead to each sample and beat for 00:05:00 .
1mm beads stored in a plastic reservoir.
Tweezers grab beads.
Tubes containing tissue, ENA, and a bead.
Notes:
- For specimens, we typically just use stainless beads as they come from the vendor, without being prepped or sterilized in any way. They are stored in a 100mL weigh boat.
- We use tweezers to grab each bead individually and place it into a cell of an 8-strip tube containing the tissue.
- We use a BioSpec Mini-Beadbeater-96 for beating, but any beadbeating methodology should work.
Heat at 80C for 10 minutes in a thermocycler.
Add50 µL of Low TE to the extract (per linked ENA protocol).
You are now ready to use the fluid as the template for a PCR reaction.
DNA Amplification
Prepare PCR reactions. Primers are ordered using the ONT-tagged primers and Master Mix protocol. We prepare all of our dual-index primer plates on an Opentrons OT2 liquid handling robot. The LifePool® primers for this pool consist of three forward and eight reverse primers. The forward primers all have the same barcode for a specimen and the reverse primers all have the same barcode for a specimen. So each sample has 11 primers in the PCR reaction and each sample has a unique tag combination. Thus an 8-strip of samples contains 88 unique primer combinations. A plate of 96 samples contains 1,056 unique primer combinations.
Forward Primers:
GGTYGATCCTGYCAG
AATCTGCGAACGGCTCCGTA
TCTCTCTGAATCTGCGWAC
Reverse Primers:
GGGGTTTAAAGGTCCCC
CRAACYCTDATCCTCTGT
CGAACTCTGATTCCCCGT
CGCGCCTGCTGCCTTCC
TGCTGGCACCAGACTTGT
GACTTGTCCTCYAATTGTTAC
GTCCTCTAATTGTTACTCGAD
ATCTCTCAGGCCCACTCTCCAGG
For a 12.5uL "half" PCR reaction, we add 0.5uL of template to each cell. The sample numbers are tracked to each individual well on the spreadsheet above.
Here is the current PCR program that we use for the pools in this protocol.
Library Prep and Sequencing
Follow the remainder of the ONT DNA Barcoding Fungal Amplicons w/ MinION & Flongle protocol for post-PCR pooling, purification, dA-tailing, adapter ligation, sequencing, and basecalling.
Primary Data Analysis
Data analysis must be performed with Specimux and Speconsense to be able to accomodate the permutational demultiplexing and consensus building that is required for primer pools.