Nov 07, 2019
Library preparation protocol to sequence V3-V4 region of 16S rRNA to run in Illumina MiSeq platform
- 1Australian National University;
- 2CSIRO Health & Biosecurity;
- 3Centre for Invasive Species Solutions
- Team Schwessinger
Protocol Citation: Somasundhari Shanmuganandam, Benjamin Schwessinger, Robyn Hall 2019. Library preparation protocol to sequence V3-V4 region of 16S rRNA to run in Illumina MiSeq platform. protocols.io https://dx.doi.org/10.17504/protocols.io.6i7hchn
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: August 15, 2019
Last Modified: November 07, 2019
Protocol Integer ID: 26943
Keywords: Illumina, Miseq, 16S, sequencing
Abstract
This is an optimised protocol for 16S library preparation of V3-V4 region for sequencing through Illumina MiSeq platform (2 x 300 bp V3 chemistry). This protocol uses Platinum™ SuperFi™ PCR Master Mix instead of 2x KAPA HiFi HotStart ReadyMix given in Illumina 16S protocol. This polymerase master mix has lower error rate than KAPA, making it more suitable for sequencing.
Materials
Equipment
- 96-well Microtiter Plate Magnetic Separation Rack
- 96-well V bottom assay sheath
- 1.5 mL Eppendorf tubes
- Eight 0.2ml PCR strip Tube, Natural, Sterile, 120/Bag
- Sealing Film, Sterile, 50 Sheets
- Multichannel pipette P1-10, P200 and their corresponding tips
- Ice & ice bucket
- Agilent Tapestation 4200
- Qubit
- MiSeq Reagent Kit v3
- Nextera XT Index Kit, 96 indices, 384 samples
- Axygen plate
- Gel tank
Reagent
- Buffer EB
- PCR Water (nuclease free)
- Fresh 80% Ethanol
- Agencourt Ampure XP beads
- High Sensitivity D1000 Reagents
- Qubit 1X dsDNA High Sensitivity Assay Kit
- 2X Platinum™ SuperFi™ PCR Master Mix
- PhiX Control v3
- Agarose
Before start
Th forward and reverse primer along with the highlighted overhang sequence used to amplify the V3-V4 region of 16S rRNA is given below.
Forward Primer: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGAGGCAGCAG
Reverse Primer: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACAAGGGTATCTAATCC
Stage 1 PCR amplification
Stage 1 PCR amplification
The PCR reaction setup is given below
| Reagents | Volume (µl) for 25µl reaction | |
| 2X Platinum™ SuperFi™ PCR Master Mix | 12.5 µL | |
| Water, nuclease-free | Upto 25 µl | |
| 10 µM forward primer | 1.25 µL | |
| 10 µM reverse primer | 1.25 µL | |
| Template DNA | 4.6 ng |
Add reagents and DNA in a sterilised PCR tube in the order given above
PCR cycle conditions:
Initial denaturation at 98°C for 30 sec
25 cycles of :
- 98°C for 10 sec
- 55°C for 15 sec
- 72°C for 30 sec
Final extension at 72°C for 10 min
Run 5 µL of PCR product in 1% agarose gel for 20 mins at 100V to check the size of the band (~460 bp)
Stage 1 Clean up
Stage 1 Clean up
Bring the AMPure XP beads to room temperature.
Prepare two Axygen plate with each well containing 200 μl of 80% ethanol
Using a multichannel pipette set to 20 μl, transfer the entire Amplicon PCR product to the Axygen plate. Change tips between samples.
Vortex the AMPure XP beads for 30 seconds to make sure that the beads are evenly dispersed.
Add 20 μl of AMPure XP beads (1:1 ratio) to each well on the plate
Gently pipette entire volume up and down 10 times using pipette
Incubate at room temperature without shaking for 5 minutes.
Place a sheath on the coppin device (a device shaped like a 96 well plate with magnets attached at each well similar to 96-well Microtiter Plate Magnetic Separation Rack) and insert into the plate wells containing PCR product
Allow beads to bind to the coppin device for 2 mins and use this device to transfer the beads to first ethanol plate.
Hold in ethanol for 30 seconds
Transfer beads to second ethanol half plate
Hold in ethanol for 30 seconds
Remove beads from ethanol using coppin device and invert it on the bench so that the beads are facing up.
Air dry at room temperature for 10 minutes (still on coppin device)
Using a multichannel pipette, add 52.5 μl of 10 mM Tris pH 8.5 (Buffer EB) to each well of the Amplicon PCR plate. Cover when not in use.
With air dried bead still on the device, insert sheath into the well containing Tris and remove the coppin device whilst leaving the sheath in the solution
Resuspend beads by gently swishing the sheath in the Tris. If beads don’t come off, use magnetic base to remove the stuck beads and remove the plate immediately.
Incubate at room temperature for 2 minutes without shaking
Put fresh sheath on Coppin device and insert into Tris for 2 mins
Remove and discard the beads and the sheath.
Using a multichannel pipette, remove the cleaned up product from the well and place it into PCR tube
Run 5 µL of cleaned-up product in 1% agarose gel for 20 mins at 100V to check the size of the band (~500 bp)
Stage 2 PCR amplification
Stage 2 PCR amplification
Nextera XT Index Kit (N7XX and S5XX) is used for the following set-up to add barcodes
PCR reaction setup is given below
| Reagents | Volume (50 µl) | |
| Platinum™ SuperFi™ PCR Master Mix | 25 µl | |
| Water, nuclease-free | upto 50 µl | |
| 2µM of index (each) | 5 µl | |
| Cleaned up DNA | 5 µl |
Cycle conditions for the above reavtion volume is
Initial denaturation at 98°C for 30 sec
8 cycles of :
- 98°C for 10 sec
- 55°C for 15 sec
- 72°C for 30 sec
Final extension of 10 min at 72°C.
Run 5 µL of PCR product in 1% agarose gel for 20 mins at 100V to check the size of the band (~550 bp)
Stage 2 PCR clean up
Stage 2 PCR clean up
Follow step 4 to step 25 but use 45 μl of AMPure XP in step 8 and 27.5 μl of 10 mM Tris pH 8.5 in step 18.
Run 5 µL of PCR product in 1% agarose gel for 20 mins at 100V to check the size of the band. Run it next to stage 1 clean up product to check whether the product size is increased by addition of barcodes
Quantification of stage 2 cleaned up product
Quantification of stage 2 cleaned up product
Quantify the stage 2 PCR product in Qubit high sensitivity assay
Run tapestation on selection of samples to check the length
Pool equimolar volume of each sample together to get a final concentration of 4 nM (1.17 ng /μl)
Qubit the pooled sample using high sensitivity assay to ensure the concentration is 4 nM (1.17 ng /μl)
Preparation of library for loading
Preparation of library for loading
Thaw MiSeq reagent cartridge in 25°C water bath
Thaw the HT1 reagent and pooled library at room temperature and store it in ice box
Prepare a fresh dilution of 0.2N NaOH (800 μl of dH20 + 200 μl of 1N NaOH)
Combine 5 μl of pooled library with 5 μl of 0.2N NaOH
Note: Work quickly from this step forward
Vortex briefly and centrifuge for 1 min at 300 g.
Incubate for 5 mins at room temperature (start as soon as centrifuge stops)
Immediately add 990 μl of pre-chilled HT1 to denatured DNA. Place in ice until needed. This gives 20 pM of denatured library
Prepare 20 pM dilution of PhiX
Dilute denatured DNA to a final concentration of 9.5 pM by taking 285 μl of denatured library and adding 315 μl of pre-chilled HT1 (final volume 600 μl )
Invert several times to mix and pulse centrifuge. Place it in ice
Dilute 20 pM denatured PhiX to same concentration as final library. Can be performed by adding 285 μl of 20 pM denatured PhiX with 315 μl pre-chilled HT1
Invert several times to mix and pulse centrifuge. Place it in ice
Combine 60 μl of denatured, diluted PhiX with 540 μl of denatured diluted library
Incubate the combined library at 96 °C for 2 min
Invert several times to mix and place on ice immediately
Invert reagent cartridge and buffer bottle to mix
Load sample into reagent cartridge
Wash flow cell with water, dry and wash with ethanol
Load flow cell, reagent cartridge, buffer bottle, waste bottle into MiSeq. Ensure sample sheet is loaded. Start the run