Jan 29, 2020
Library Preparation of Bee 18S and 28S rRNA amplicons for High-Throughput Illumina Sequencing
- Brian Darby1,
- Russ Bryant2,3,
- Abby Keller1,
- Madison Jochim1,
- Josephine Moe1,
- Zoe Schreiner1,
- Carrie Pratt1,
- Ned H. Euliss Jr.2,
- Mia Park1,4,
- Rebecca Simmons1,
- Clint Otto2
- 1Department of Biology, 10 Cornell St. Stop 9019, University of North Dakota, Grand Forks, ND 58202;
- 2US Geological Survey, Northern Prairie Wildlife Research Center, 8711 37th Street SE, Jamestown, North Dakota, 58401;
- 3Humboldt State University, College of Natural Resources and Sciences, 1 Harpst St, Arcata, CA 95521;
- 4Department of Biological Sciences, Dept 2715, PO Box 6050, North Dakota State University, Fargo, ND 58108-6050
Protocol Citation: Brian Darby, Russ Bryant, Abby Keller, Madison Jochim, Josephine Moe, Zoe Schreiner, Carrie Pratt, Ned H. Euliss Jr., Mia Park, Rebecca Simmons, Clint Otto 2020. Library Preparation of Bee 18S and 28S rRNA amplicons for High-Throughput Illumina Sequencing. protocols.io https://dx.doi.org/10.17504/protocols.io.bapqidmw
Manuscript citation:
Darby B, Bryant R, Keller A, Jochim M, Moe J, et al. (2020) Molecular sequencing and morphological identification reveal similar patterns in native bee communities across public and private grasslands of eastern North Dakota. PLOS ONE 15(1): e0227918. https://doi.org/10.1371/journal.pone.0227918
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: December 19, 2019
Last Modified: January 29, 2020
Protocol Integer ID: 31184
Keywords: bees, pollinators, sequencing, identification, rRNA, Illumina, MiSeq, 18S, 28S
Abstract
The objective of this protocol is to prepare amplicon sequencing libraries for high-throughput sequencing (via Illumina MiSeq) of the 18S SSU rRNA and 28 LSU rRNA loci for molecular identification of bee communities.
Guidelines
For best results, process samples as soon as possible after they are collected from the field (with not storage or freezing time if possible).
Materials
MATERIALS
DNeasy 96 Blood & Tissue Kit QiagenCatalog #69581
Molecular Biology Grade WaterFisher ScientificCatalog #10154604
DreamTaq™ Hot Start Green PCR Master MixThermo FisherCatalog #K9021
2.0-ml flat bottom microcentrifgue tubes
ceramic beads
96-well PCR plates
96-well plate adhesive sealing film
Zymo 96-well cleanup kit
Sample preparation and gDNA extration
Sample preparation and gDNA extration
Place one mesothoracic leg from each specimen (of a sample) into a 2.0 ml microcentrifuge tube, and repeat this with a new microcentrifuge tube for all samples that are to be separately barcoded.
Add five ceramic beads and 500 ul genomic lysis buffer from the desired DNA extraction kit (e.g. Qiagen 96-well Tissue and Cells) to each tube. Optional: and two mealworm beetle (Tenebrio molitar) legs as inter-sample controls.
Lyse tissue at room temperature overnight, then pulverize for 10 min in a TissueLyser prior to proceeding with the desired genomic DNA extraction kit instructions (e.g. Qiagen 96-well Tissue and Cells kit). Elute DNA into 60 ul elution buffer, pH 8.0.
First Round PCR Amplifcation
First Round PCR Amplifcation
Prepare Master Mix 1 for each locus separately (18S and 28S) for first-round PCR amplification:
| Volume (per reaction) | Working stock concentration | Reagent | |
| 10 ul | 2X | DreamTaq MasterMix | |
| 0.4 ul | 10 uM | 18S FOR primer BD0150* | |
| 0.4 ul | 10 uM | 18S REV primer BD0151* | |
| 8.2 ul | Molecular grade water | ||
| 19 ul Total MasterMix1 |
*For the 28S locus, use FOR primer BD0152 and REV primer BD0153.
BD0150 = 5' TCGTCGGCAGCGTCAGATGTGTATAAGAGACA GTGCGGTTAAAAAGCTCGTAGTTG 3'
BD0151 = 5' GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA GAACCATACTTCCCCCGGAAC 3'
BD0152 = 5' TCGTCGGCAGCGTCAGATGTGTATAAGAGACA GTGAAACCGTTCAGGGGTAAACC 3'
BD0153 = 5' GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA GGTGTTTCAAGACGGGTCCTG 3'
(underlined portions anneal to gDNA targets)
For each locus separately, add 19 ul of Master Mix 1 and 1 ul of gDNA (10 ng/ul) to a suitable PCR reaction tube (or well in a 96-well plate).
Amplify first round PCR reactions in a thermocycler with 30 cycles of 95 °C for 0:30, 55 °C for 0:30, and 72 °C for 0:30, followed by a final extension at 72 °C for 5 minutes.
Keeping each sample separate, pool 10 ul of PCR product from each locus (e.g. 18S and 28S), and purify with a PCR clean-up kit (e.g. Zymo 96-well PCR CLeanup kit).
Second Round PCR Amplification
Second Round PCR Amplification
For each sample, add reagents to an appropriate PCR reaction tube (or well of a 96-well plate):
| Volume (per reaction) | Working stock concentration | Reagent | |
| 10 ul | 2X | DreamTaq MasterMix | |
| 2 ul | 2 uM | FOR Nextera barcoded primer* | |
| 2 ul | 2 uM | REV Nextera barcoded primer* | |
| 5 ul | Molecular grad water | ||
| 2 ul | purified 1st-round PCR product | ||
| 20 ul Total reaction volume |
*FOR Nextera barcoded primer = 5' AATGATACGGCGACCACCGAGATCTACAC NNNNNNNN TCGTCGGCAGCGTC 3'
*REV Nextera barcoded primer = 5' CAAGCAGAAGACGGCATACGAGAT NNNNNNNN GTCTCGTGGGCTCGG 3'
where "NNNNNNNN" is a unique 8-nt barcode sequence.
Amplify second round PCR reactions in a thermocycler with 8 cycles of 95 °C for 0:30, 55 °C for 0:30, and 72 °C for 0:30, followed by a final extension at 72 °C for 5 minutes.
Pool 5 ul of second-round PCR product from each sample and clean half of this using a PCR cleanup kit (e.g. Zymo PCR Cleanup kit). Elute in 30 ul elution buffer (EB), pH 8.0, and this eluted product is ready to submit for cluster formation on the Illumina MiSeq (using 2x300 bp paired end reads).
For best results, gel purify a large portion of the cleaned second-round PCR products to target the >500 bp bands and minimize <200 bp dimers (which can occupy a disproportionately large number of flowcell colonies if they are present).