Dec 11, 2020

Public workspaceLibrary Adapter Preparation for Dual-Index Double Stranded DNA Illumina Sequencing

Library Adapter Preparation for Dual-Index Double Stranded DNA  Illumina Sequencing
  • Franziska Aron1,
  • Guido Brandt2
  • 1Friedrich-Schiller Universität Jena;
  • 2Department of Archaeogenetics, Max Planck Institute for the Science of Human History
  • WarinnerGroup
  • MPI EVA Archaeogenetics
Icon indicating open access to content
QR code linking to this content
Protocol CitationFranziska Aron, Guido Brandt 2020. Library Adapter Preparation for Dual-Index Double Stranded DNA Illumina Sequencing. protocols.io https://dx.doi.org/10.17504/protocols.io.bem5jc86
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: April 06, 2020
Last Modified: December 11, 2020
Protocol Integer ID: 35229
Keywords: ancient DNA, palaeogenetics, archaeogenetics, DNA, Illumina, aDNA, nucleic acids, paleogenetics, archeogenetics, library preparation, genomic DNA, genomics, ancient dna library preparation for illumina, ancient dna libraries for illumina next, stranded ancient dna library preparation, sequencing adapter preparation protocol, stranded ancient dna library, based ancient dna library, ancient dna library, library adapter preparation, library adapter preparation for dual, index double stranded dna, adapter preparation protocol, stranded dna, sequencing, adapter mix, production of an adapter mix, dna, library preparation, library, illumina next
Abstract
Adapter preparation protocol for doubble-stranded ancient DNA libraries for Illumina Next-Generation-Sequencing, based on Meyer and Kircher et al. (2010) Cold Spring Harb. Protoc. (doi: 10.1101/pdb.prot5448).

The protocol describes the production of an adapter mix for 2000 libraries.

This protocol is used in conjunction with Meyer and Kircher-based ancient DNA libraries and is described accordingly (see library construction like: Non-UDG treated double-stranded ancient DNA library preparation for Illumina sequencing).
Image Attribution
Matthäus Rest
Guidelines
Working in an Ancient DNA Laboratory
- All steps of the protocol should take place in a clean room facility specifically designed for ancient DNA.
- The researcher performing lab work should wear correspondingly suitable lab-wear, such as:
- full-body suit with hood (e.g., Tyvek)
- hairnet
- face mask
- two pairs of clean gloves
- clean shoes
- protective glasses
- Sample processing should be carried out in separated work benches with integrated UV irradiation (e.g. Dead Air PCR work bench)
- Surfaces and equipment should be regularly decontaminated with e.g. bleach solution or Thermofisher's DNA AWAY (or similar) and irradiated with UV.
- All home-made buffers should be prepared in a seperate decidated PCR-free ultra-clean room and UV-irradiated for 30 min.

Please see the following for more detailed guidance:

Llamas, B. et al., 2017. From the field to the laboratory: Controlling DNA contamination in human ancient DNA research in the high-throughput sequencing era. STAR: Science & Technology of Archaeological Research, 3(1), pp.1–14. Available at: https://doi.org/10.1080/20548923.2016.1258824.
All steps of the protocol should take place in a clean room facility specifically designed for ancient DNA.

Protocol Specific Guidelines
This protocol requires the use of a two rooms - a buffer preparation room and a library preparation room.
Materials
MATERIALS
Reagent2 ml LoBind TubesEppendorfCatalog #0030108078
Reagent0.2 ml PCR Tube stripsEppendorfCatalog #0030124359
Reagent1.5 ml LoBind tubesEppendorfCatalog ##0030108051
ReagentEDTA (0.5 M) pH 8.0Life TechnologiesCatalog #AM9261
Reagent5 M Sodium chloride (NaCl)Merck MilliporeSigma (Sigma-Aldrich)Catalog #S5150-1L
ReagentTris-HCLLife TechnologiesCatalog #15568025
ReagentWater HPLC PlusMerck MilliporeSigma (Sigma-Aldrich)Catalog #34877-2.5L-M
Lab Equipment
PCR Thermocycler (e.g. Eppendorf Mastercycler Nexus)
UV irradiation box or cross linker (e.g. Vilber Lourmat Bio-Link BLX-254)

Additional Reagents
Oligos (e.g. SigmaAldrich Custom DNA Oligos)
Oligo IDSequence (5'-3')Concentration
IS1_adapter.P5.FA*C*A*C*TCTTTCCCTACACGACGCTCTTCCG*A*T*C*T500 µM
IS2_adapter.P7.FG*T*G*A*CTGGAGTTCAGACGTGTGCTCTTCCG*A*T*C*T500 µM
IS3_adapter.P5+P7.RA*G*A*T*CGGAA*G*A*G*C500 µM
* indicates a PTO bond


Troubleshooting
Safety warnings
Reagents
Household bleach solution (2-6%) diluted to a working concentration of 0.2-0.5 % NaClO in total
- H290 May be corrosive to metals.
- H314 Causes severe skin burns and eye damage.
- H411 Toxic to aquatic life with long lasting effects.
- EUH206 Warning! Do not use together with other products. May release dangerous gases (chlorine). Remove from surface after recommended incubation time with water-soaked tissue.


DNA AWAY
- H314 Causes severe skin burns and eye damage.

Note: Both bleach solutions and DNA AWAY are used for decontamintation. DNA AWAY is less corrosive than bleach and should be preferred for decontamination of sensitive equipments such as surfaces of electric devices.

EDTA
- H373 May cause damage to organs through prolonged or repeated exposure.

Sodium Chloride
-H290 May be corrosive to metal
-H314 Causes severe skin burns and eye damage
-H400 Very toxic to aquatic life


Equipment
UV radiation
- UV radiation can damage eyes and can be carcinogenic in contact with skin. Do not look directly at unshielded UV radiation. Do not expose unprotected skin to UV radiation.
- UV emitters generate ozone during operation. Use only in ventilated rooms.


Before start
Planning
This protocol takes around 3 hours including the cleaning process of the workspace afterwards.

Preparation of Reagents
Only the oligo hybridisation buffer can be prepared within buffer preparation room, with a DNA-free hood. All other steps are performed in the the library preparation room.

HPLC-Water should be decontaminated with a 30 min UV irradiation before use.

Equipment
Make sure all necessary equipment is available (see Materials)

Abbreviations
EDTA = Ethylendiaminetetraacetic acid
HPLC = High Performance Liquid Chromatography (-Grade Water)
NaCl = Sodium chroride
Tris-HCl = Tris hydrochloride
UV = Ultraviolet (radiation)
Hybridization buffer preparation (Buffer Preparation Room)
Prepare oligo hybridization buffer (10× concentration, Amount1 mL for 50 reactions )

ReagentStock concentration [M]Final Concentration [M]1× Volume [µl]
NaCl50.5100
Tris-HCl10.0110
EDTA0.50.0012
UV HPLC-water888
Total1000


Note
The oligo hybridization buffer can be stored at room temperature for up to one year.

Irradiate the buffer with UV for Duration00:30:00 without the lid or with an open lid.
Adapter Preparation (Library Preparation Room)
Prepare P5 adapter (Amount100 µL per reaction )
Use one tube of a 0.2 ml PCR strip to set up the P5 adapter mix.

ReagentStock concentrationFinal concentration1× Volume [µl]
Oligo Hybridization Buffer10 ×1 ×10
IS1_adapter.P5500 µM200 µM40
IS3_adapter.P5+P7500 µM200 µM40
UV HPLC-water10
Total100

Gently pipette up anddown to mix. Split the Amount100 µL reaction into two tubes of the 0.2ml PCR strip with Amount50 µL each .

Prepare P7 adapter (Amount100 µL per reaction )
Use one tube of a 0.2 ml PCR strip to set up the P7 adapter mix.


ReagentStock concentrationFinal concentration1× Volume [µl]
Oligo Hybridization Buffer10 ×1 ×10
IS2_adapter.P7500 µM200 µM40
IS3_adapter.P5+P7500 µM200 µM40
UV HPLC-water10
Total100
Split the Amount100 µL reaction into two tubes of the 0.2ml PCR strip with Amount50 µL each .

Prepare ready-to-use adapter mix.
Combine one P5 adapter reaction with one P7 adapter reaction in one tube, mix thoroughly by flicking the tubes with a finger, spin down briefly.


Repeat with the second P5 and P7 adpater reaction.


Note
In the end you should have two 0.2 ml tubes with a total of Amount100 µL volume, each containing Amount50 µL of the P5 adapter and Amount50 µL of the P7 adapter.


Mix
Incubate both reactions in a thermocyler with a heated lid at Temperature95 °C for Duration00:00:10 ,


followed by a cool down ramp from Temperature95 °C to Temperature12 °C at a rate of Temperature0.1 °C per sec .





Critical
Combine and Dilute
Combine both reactions into a 2 ml tube to obtain a ready-to-use double-stranded library adapter mix with Concentration100 micromolar (µM) adapter (each) .
Mix
Add Amount1800 µL of UV HPLC-water to dilute the double-stranded library adapter mix to Concentration10 micromolar (µM) and aliquot the dilution in 10 × 1.5 ml LoBind tubes, each containing Amount200 µL . Briefly vortex and spin down before freezing.
Store the adapter mix at Temperature-20 °C
Note
Each aliquot contains sufficient double-stranded library adapter mix for 200 reactions (overall 2000 libraries).

The adapter mix aliquot can be thawed and re-frozen with no detriment to the reagent quality.