Apr 22, 2026
LDLR Prime Editing Screening
- Quang Vinh Phan1,
- Felicitas Vogd1,
- Phillip Zhou1,
- Minja Simon1,
- Tian Yu1,
- Jayoung Ryu2,
- Luca Pinello3,
- Christopher Cassa1,
- Richard Sherwood1
- 1Division of Genetics, Department of Medicine, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA, USA;
- 2The Courant Institute School of Mathematics, Computing, and Data Science;
- 3Molecular Pathology Unit and Center for Cancer Research, Massachusetts General Hospital Research Institute, Department of Pathology, Harvard Medical School, Boston, USA
Protocol Citation: Quang Vinh Phan, Felicitas Vogd, Phillip Zhou, Minja Simon, Tian Yu, Jayoung Ryu, Luca Pinello, Christopher Cassa, Richard Sherwood 2026. LDLR Prime Editing Screening. protocols.io https://dx.doi.org/10.17504/protocols.io.kxygxjb2kl8j/v1
Manuscript citation:
LDLR variant classification through activity-normalized prime editing screening
Phillip J. Zhou, Minja Velimirovic, Tian Yu, Vojislav Gligorovski, Nicolas Mathis, Jing Zhao, Quang Vinh Phan, Felicitas Vogd, Jayoung Ryu, Qisheng Pan, Atharva Tyagi, David B. Ascher, Gerald Schwank, Luca Pinello, Christopher A. Cassa, Richard I. Sherwood
bioRxiv 2025.12.16.694467; doi: https://doi.org/10.64898/2025.12.16.694467
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
Created: April 20, 2026
Last Modified: April 22, 2026
Protocol Integer ID: 315408
Keywords: crispr screen, snp, ldl uptake screen, prime editing, activity normalization, variant clinical classification, ldlr prime editing screening, ldlr variant effect on cholesterol uptake, deep mutational scanning of the ldlr gene, crispr prime editing, ldlr gene, functional consequences of ldlr variant, deleterious ldlr variant, ldlr variant, low density lipoprotein receptor, density lipoprotein cholesterol, using prime editing, ldlr, prime editing, using crispr, measuring ldlr, familial hypercholesterolemia, high ldl, screen ldlr137, primary cause of familial hypercholesterolemia, variants in the hct116 cell line, deep mutational scanning, cholesterol uptake, ldl, entire length of ldlr, screening, hct116 cell line, premature cardiovascular disease
Funders Acknowledgements:
Luca Pinello
Grant ID: UM1HG012010
Abstract
The low density lipoprotein receptor (LDLR) removes low-density lipoprotein cholesterol (LDL-C) from circulation, and deleterious LDLR variants are the primary cause of familial hypercholesterolemia, a condition characterized by exceptionally high LDL-C levels and an increased risk of premature cardiovascular disease. Measuring the functional consequences of LDLR variants is challenging, so to address this issue, we have developed a method for using prime editing to perform deep mutational scanning of the LDLR gene.
This protocol describes pooled LDL uptake screening using CRISPR prime editing to install variants in the HCT116 cell line, with the goal of measuring LDLR variant effect on cholesterol uptake in vitro.
Note that the specific protocol described here was for our LDLR-FL screen, where we targeted the entire length of LDLR. We also describe a screen LDLR137-219 in our paper, which for the purposes of this experiment is almost identical, except for the fact that the plasmid used for prime editing is slightly different.
Library cloning
Library structure
U6 stub-[19-20-nt gRNA]-gRNA hairpin-[PBS/RT]-tevO-Q1 motif-terminator-[Reporter]-[7 nt barcode]-R2seq stub
tgtggaaaggacgaaacaccg[19-nt gRNA spacer] GTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC[PBS/RT]CGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAATTTTTT[Reporter][7-nt barcode]AGATCGGAAGAGCACACGTCT
Reconstitution of ssDNA oligo pool
Spin down lyophilized ssDNA oligo pool
Prepare 2 ng/µL stock by resuspending in TE buffer with low EDTA (10 mM Tris-Cl pH 8.0, 0.1 mM EDTA)
Store at -20°C.
Restriction digest of pLenti U6_r2ad_IN-PE2-SSB_PuroR library backbone
Cut 10 µg pLenti U6_r2ad_IN-PE2-SSB_PuroR with BsmBI-V2
Restriction digest reaction mix overview:
| A | B | |
| H2O | to 100 µL | |
| NEBuffer r3.1 | 10 µL | |
| pLenti U6_r2ad_ IN-PE2-SSB_PuroR | 10 µg | |
| BsmBI-v2 | 10 units |
Incubate at 55 °C for 3-4 hours with BsmBI-V2
Run digest on 1% agarose gel with SYBR and cut out band at 16.38 kbp. Distribute 100 uL digest reaction among 3 large agarose gel wells (12 tooth comb, 1.5 mm thickness).
Amplification of library
Amplification of library done with the following primers:
010415_sgRNA_60bp_fw
TAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCT TGTGGAAAGGACGAAACACCG
062024_r2seq_i722_BsrGrv
TTTAAAACTTTATCCATCTTTGCATGTACA GAAGACGGCATACGAGAT NN CTGCGC GTGACTGGAGTTC AGACGTGTGCTCTTCCGATCT
Determination of optimal PCR cycles for library amplification
Run a qPCR with 0.5 µL of 100924_fullLDLR_pegRNA_library in 15 µL qPCR to determine optimal cycles using the primers above.
qPCR mix
| A | B | |
| Oligo pool | 0.5 µL | |
| 2x NEBNext Ultra II Q5 Master Mix | 7.5 µL | |
| 010415_sgRNA_60bp_fw (20 µM) | 0.375 µL | |
| 062024_r2seq_i722_BsrGrv (20 µM) | 0.375 µL | |
| ddH2O | 5.5 µL | |
| 20x EvaGreen | 0.75 µL |
qPCR program
| A | B | C | D | E | F | |
| 98 °C | 98 °C | 69 °C | 72 °C | 72 °C | 4 °C | |
| 30 sec | 10 sec | 30 sec | 60 sec | 5 min | remaining |
Repeat steps B-D for 25 cycles
Identify the cycle number where the qPCR stops log-linear increase (this is typically 4-6 cycles after the CT), determine how much more input in PCR as in qPCR and subtract 5 cycles to identify PCR cycle number.
Library amplification
Once optimal cycle number is determined, run a 100 µL PCR with the following conditions:
| A | B | |
| Oligo pool | 2-4% of resuspended library | |
| 2x NEBNext Ultra II Q5 Master Mix | 50 µL | |
| 010415_sgRNA_60bp_fw (20 µM) | 2.5 µL | |
| 062024_r2seq_i722_BsrGrv (20 µM) | 2.5 µL | |
| ddH2O | to 100 µL |
| A | B | C | D | E | F | |
| 98 °C | 98 °C | 69 °C | 72 °C | 72 °C | 4 °C | |
| 30 sec | 10 sec | 30 sec | 60 sec | 5 min | remaining |
Repeats steps B-D with the determined optimal cycle numbers.
Load PCR onto a 2% agarose gel with SYBR (3 large wells, 12 tooth comb, 1.5 mm thickness) and gel purify band around 350-410 bp. There will be a smear in this size range: make to include the entire size range, as pegRNA length varies and we want to include all pegRNAs. Elute in 50 µL EB.
Perform PCR purification on this eluted gel purification. Start by mixing 50 µL eluted gel purification product with 250 µL buffer PB and continue with standard Qiagen PCR purification protocol. Elute in 30 µL EB.
Gibson assembly
| A | B | |
| 2x NEB HiFi DNA Assembly Master Mix | 50 µL | |
| Digested pLenti U6_r2ad_ IN-PE2-SSB_Puro | 2500 ng (0.24 pmol) | |
| Purified library PCR | 176 ng (0.75 pmol) | |
| Water | to 100 µL |
Incubate at 50°C for 1 hour.
Cleanup/concentration
Add 1 µL GlycoBlue, 2 µL 50mM NaCl, and 100 µL Isopropanol to the 100 µL Gibson reaction
Vortex, incubate at room temperature for 15 min
Spin > 15,000 x g for 15 min
Carefully remove liquid without disturbing pellet. This can be achieved by using a P200 and a P20/P10 afterwards to remove all liquid.
Wash with 300 µL 80% EtOH and spin at >15,000 x g for 5 min
Remove most liquid with P1000 and spin at >15,000 x g for 1 min
Carefully remove all liquid with P200, making sure tube has no liquid left (this can be achieved by using a P200 and a P20/P10 afterwards to remove all liquid) and air-dry pellet for 3-5 minutes by keeping cap open and leaving at room temperature
Add 8.25 µL EB, warming at 55°C for 10 minutes to fully resuspend
Determination of Coverage and Diversity of Cloned Library
Transformation of a small amount of the assembly mix for the determination of diversity and coverage of the cloned library.
Add 0.25 µL of the purified assembled mix into a 1.5 mL tube and gently mix with 25 µL of NEB Stable cells. Incubate for 30 minutes on ice.
Heat shock at exactly 42°C for 30 seconds and put back on ice for 5 minutes.
Add 975 µL of NEB 10-beta/Stable Outgrowth Medium and incubate at 30°C for 1 hour while shaking.
Plate 1/10, 1/100, and 1/1,000 of transformation mix onto LB agar plates (supplied with 100 µg/mL ampicillin). Incubate at 30°C overnight.
Calculation of the Coverage
Choose the dilution plate with colony numbers in the range between 20-200 and count the colonies. Calculate the coverage as follows:
((Counted colonies * dilution factor) / Number of library members) * 1600
A coverage of >100x is ideal.
Note: 0.25 µL of the remaining 8 µL purified assembly mix is 32x used in this test. Electroporation with Endura typically yields in a 50x higher transformation efficiency compared to NEB Stable cells, meaning that the entire remaining 8 µL of the assembly mix has 32x50=1600x the number of colonies as the test transformation with 0.25 µL.
Determination of the Diversity
Perform colony PCR on 16 colonies from any of the dilution plates to determined the diversity of the cloned library, using the following conditions:
091324_U6_latefw
ATTTCTTGGGTAGTTTGCAGTTT
031621_postSmarv
GCTGCAAAGATTCCTCTCTG
PCR mix for one reaction:
| A | B | |
| NEB OneTaq 2X Master Mix with Standard Buffer | 12.5 µL | |
| 091324_U6_latefw (20 µM) | 0.625 µL | |
| 031621_postSmarv (20 µM) | 0.625 µL | |
| Water | add 11.25 µL |
PCR program:
| A | B | C | D | E | F | |
| 94 °C | 94 °C | 50°C | 72 °C | 72 °C | 4 °C | |
| 30 sec | 15 sec | 30 sec | 60 sec | 5 min | remaining |
Repeat steps B-D for 35x
Load 5 µL of each PCR onto a 2% agarose gel with ethidium bromide and expect bands at 400-500 bp for successful cloning, while >1000 bp indicates plasmid background. If >2 colonies have 1000 bp bands, then re-clone.
Purify rest of the colony PCR via QIAquick PCR Purification Kit and send in for Sanger sequencing with primer 091324_U6_latefw (ATTTCTTGGGTAGTTTGCAGTTT). Check the cloned sgRNAs for diversity and move on to the electroporation of the assembly mix into Endura cells.
Electroporation of Assembly Mix in Endura Cells
Add 2 µL of assembly mix to 25 uL of Lucigen Endura electrocompetent cells, repeat 4x
Electroporate using the following parameters:
- 1mm cuvette (pre-chilled on ice)
- 10 μF
- 600 Ohms
- 1800 Volts
Immediately add 1 mL recovery media from Lucigen into the electroporation cuvette.
Gently pipet bacterial suspension into a 14 mL culture tube that already contains 1 mL of Lucigen recovery media
Incubate at 30°C for 1 hour while shaking.
In a 50 mL centrifugation tube, pool all 4 electroporation mixes together and mix well by swirling.
Take out 10 µL of the pooled electroporation mix and add to 1 mL of recovery medium. Plate out 20 and 100 µL of that dilution onto pre-warmed plates (supplied with 100 µg/mL ampicillin, 40,000 and 8,000-fold dilution, respectively). Incubate at 30°C overnight and count colonies to determine the coverage (see step 7.5 for calculation).
Transfer the pooled electroporation mix into 400 mL LB medium supplied with 100 µg/mL ampicillin. Incubate at 30°C overnight while shaking.
Centrifuge bacterial suspension as 2x200 mL aliquots (3000 x g, 4°C, 20 minutes). Maxi prep one bacterial pellet and keep the other one as backup at -20°C.
Lentivirus Production and Cell Sorting
Production and Titration of Lentivirus
Day -1: Plate HEK293 cells for Transfection
Plate 4x15 cm plates with HEK293FT cells at 1.625 x 107 cells per 15-cm plate in 20 mL DMEM + 10% FBS each
Day 0: Transfection of Lentiviral Plasmid Library
Cells should be 50-60% confluent. Aspirate media and replace with 16 mL DMEM + FBS (one plate at a time since HEK cells do not tolerate being dry). Prepare 2 separate tubes with the following components per 15-cm plate:
Tube A
| A | B | |
| OptiMEM | 4 mL | |
| pMDLg/pRRE | 9.7 µg | |
| pRSV-Rev | 6.5 µg | |
| pcDNA3-VSV-G | 3.3 µg | |
| Lentiviral Plasmid Library | 13 µg |
Tube B
| A | B | |
| OptiMEM | 4 mL | |
| TransIT-Lenti Transfection Reagent | 98 µl |
Mix the contents of tube B into A and gently invert. Incubate for 15 minutes at room temperature.
Gently add transfection mix dropwise to the cells.
Day 1: First Harvest
Collect lentiviral supernatant and store at 4°C. Replace medium with 16 mL of DMEM+10% FBS.
Day 2: Second Harvest
Collect lentiviral supernatant and store at 4°C. Replace medium with 16 mL of DMEM+10% FBS.
Day 3: Final Harvest and Lentivirus Concetration
Collect lentiviral supernatant and pool all lentivirus harvest together.
Centrifuge pooled lentiviral supernatant at 300 x g for 5 minutes. Filter supernatant through a 0.45 µm filter and add 1/3 supernatant volume of Lenti-X Concentrator. Mix gently by inversion and incubate for 30 minutes or overnight at 4°C.
Centrifuge at 1,500 x g for 45 minutes at 4°C.
Gently pour out the supernatant and resuspend pellet in 2 mL of DMEM+10% FBS per 15 cm. Aliquot 500 µL per cryovial and store at -80°C, saving two 60 µL aliquots for lentiviral titration
Titration of Lentivirus
Titrate the lentivirus on a 24 well plate using 5.2 x 104/well (2.6 x 104/cm2). Eventual experiment will use 3.91M (3.91 x 106) cells on a 15-cm (2.6 x 104/cm2). Each 24-well of titration uses ~1/75 as many cells as the 15-cm plate will.
Below is the standard lentivirus titration dose chart, although you can alter if necessary. Volumes are calculated for 4 mL total lenti and should be adjusted as necessary to account for fraction of lenti produced:
‱ 1/150 = 26.66 µL
‱ 1/300 = 13.33 µL
‱ 1/600 = 6.66 µL
‱ 1/1200 = 3.33 µL
‱ 1/1800 = 2.22 µL
‱ 1/2400 = 1.67 µL
‱ 1/4800 = 0.83 µL
Day 0: Plating and Infection of HCT116 Cells
Plate 52,000 HCT116 cells per well in a 24-well supplied with polybrene in a final concentration of 8 µg/mL. Add lentivirus in the dilution steps as stated above. Have two extra wells seeded with no virus as selection control.
Day 2: Start of Puromycin Selection
Replace medium with DMEM+10% FBS supplied with 500 ng/mL puromycin
Day 3: First Passage
Wash cells with PBS and add 75 µL of trypsin. Incubate for 5 minutes at 37°C and add 500 µL of medium supplied with puromycin. Mix detached cells with a P1000 and transfer cell suspension to a new 24-well.
Day 5: Second Passage
Wash cells with PBS and add 75 µL of trypsin. Incubate for 5 minutes at 37°C and add 500 µL of medium supplied with puromycin. Mix detached cells with a P1000 and transfer cell suspension to a new 24-well.
Day 7: Count
By now, control well with no virus should be completely dead. Count each well and detemine the lentiviral dose with the highest survival. The lentiviral dose with 50% survival from that is then the desired lentiviral dosage for the screen. Multiply the dosage with 75 to scale the lentiviral dosage to the 15 cm dish format.
Lentivirus Library Infection and LDL
Day 0: Infection of HCT116 Cells
Trypsinze and count HCT cells. Add 3.91 x 106 cells to a 15 mL centrifugation tube, add appropriate amount of lentivirus library as calculated from the titration and mix by gently inverting. Plate mix onto 15 cm dish with a total medium volume of 20 ml supplied with 8 µg/mL polybrene. Repeat this for a total number of 4 replicates.
Seed 266,000 HCT116 cells in a 6-well as selection control.
Day 3: Start of Puromycin Selection
Replace medium with 20 µL of McCoy+10% FBS supplied with 500 ng/mL puromycin.
Day 4: First Passage
Split cells 1:2 to one new 15 cm dish with 20 ml of McCoy+10% FBS supplied with 500 ng/mL puromycin (ending up with one plate per replicate).
Day 6: Second Passage
Split cells 1:2 to two new 15 cm dish with 20 mL of McCoy+10% FBS supplied with 500 ng/ml puromycin (ending up with two plates per replicate). By now, control 6-well with no virus should be dead.
Day 8: Seed for LDL Uptake Screen
Seed 31.25 x 106 cells per replicate in a 15 cm dish. For bulk, seed 12.25 x 106 cells in a 10 cm dish. Seed both in McCoy+10% FBS.
Day 9: Serum Starvation
In the late afternoon, change medium to OptiMEM to start serum starvation.
Day 10: LDL Uptake Screen
1. 4-6 hours prior to the FACS sort, replace medium of each replicate plate with 16 mL of
OptiMEM supplied 40 µL with Low Density Lipoprotein from Human Plasma, BODIPY
FL complex (BODIPY FL LDL).
2. Harvest one plate at the time - trypsinze and spin down to collect cell pellet,
resuspend in DMEM+10% FBS supplied with DAPI
3. Sort cells based on BODIPY signal in the following bins: Bottom 20%, Bottom 20-40%, Top 20-40%, and Top 20%.
4. Isolate genomic DNA from sorted cells and bulk cells via PureLink Genomic DNA Mini Kit and elute gDNA in 100 µL.
Library Preparation for NGS
Determination of CT Values for Pooling in PCR1
Perform qPCR1 to determine CT values of each sample. These values will be used to pool samples prior to PCR1 purification. Use the following primers:
101317_U6PE1_BcX (ACTCTTTCCCTACACGACGCTCTTCCGATCT NNNNN GGAAAGGACGAAACACCG)
112822_P7_anchor (CAAG CAGAAGACGGCATACGAGAT)
qPCR for one reaction:
| A | B | |
| gDNA | 0.5 µL | |
| 2x Q5 Ultra II Master Mix | 7.5 µL | |
| 101317_U6PE1_BcX (20 µM) | 0.375 µL | |
| 112822_P7_anchor (20 µM) | 0.375 µL | |
| 20x EvaGreen | 0.75 µL | |
| dH20 | 5.5 µL |
qPCR1 program
| A | B | C | D | E | F | |
| 98°C | 98°C | 65°C | 72 °C | 72 °C | 4 °C | |
| 30 sec | 10 sec | 30 sec | 60 sec | 5 min | remaining |
Repeat steps B-D for 30x
After collecting CT values for each sample, organize samples into pools such that samples in each pool have CT values within 0.5 cycles of each other. This step is done to minimize the complexity and time of PCR1 purification and further steps of NGS preparation (qPCR2, PCR2). Note that bulk gDNA samples should never be pooled with sorted samples, regardless of CT similarity. Also note that every
sample you wish to pool after PCR1 MUST use a distinct U6PE1 barcoded primer.
PCR1 for cell-integrated libraries
Choose a distinct U6PE1 barcoded primer for each sample to the extent possible (we have 24 distinct primers). This helps to minimize monotemplate because the barcoded primers are staggered, and it allows
demultiplexing of each sample with a distinct U6PE1 during NGS analysis. You may also pool samples during PCR1 purification if they have distinct U6PE1s and qPCR1 showed Ct <0.5 cycles apart.
| A | B | |
| gDNA | 20 µg gDNA or all the gDNA | |
| 2x Q5 Ultra II Master Mix | 400 µL | |
| 101317_U6PE1_BcX (20 µM) | 20 µL | |
| 112822_P7_anchor (20 µM) | 20 µL | |
| dH20 | to 800 µL |
Cycling (25 cycles):
| A | B | C | D | E | F | |
| 98 °C | 98 °C | 65 °C | 72 °C | 72 °C | 4 °C | |
| 30 sec | 10 sec | 30 sec | 60 sec | 5 min | remaining |
You may combine samples with similar CTs (typically within 0.5 cycles, pool bulk samples separately from sorted samples) provided that they used distinct U6PE1 primers in PCR1. Add 5x volume of buffer PB and proceed to PCR purify via Qiagen PCR purification kit each pool using 1 column per pool, eluting in 100 uL EB per pool. Note that you may want to use tube extenders since there can be a lot of volume to go through one column.
Determination of CT Values for Optimal Cycle Number in PCR2
| A | B | |
| PCR1 pool | 0.5 µL | |
| 2x Q5 Ultra II Master Mix | 7.5 µL | |
| NEBNext_i5 (20 µM) | 0.375 µL | |
| 030322_P7_anchor (20 µM) | 0.375 µL | |
| 20x EvaGreen | 0.75 µL | |
| dH2O | 5.5 µL |
| A | B | C | D | E | F | |
| 98 °C | 98 °C | 71 °C | 72 °C | 72 °C | 4 °C | |
| 30 sec | 10 sec | 30 sec | 60 sec | 5 min | remaining |
Repeat step B-D for 30x
Use 2-3 cycles less than the qPCR Ct for PCR2 (it’s OK to use up to 3 cycles less than qPCR Ct and up to qPCR Ct so as to group samples most efficiently). Minimum number of PCR2 cycles is 5. If 2-3 below the CT value is <5, then use less PCR1 product input for PCR2 to compensate for 5 cycles. Ex: if your CT is 5, then 2 cycles below the CT would be 3. In order to run the minimum of 5 cycles, add in 1/4 of the normal amount of PCR1 product (so 6ul) to compensate for the two extra PCR cycles.
PCR2
PCR 2 50 uL Reaction system:
| A | B | |
| PCR1 pool | 22.5 µL | |
| 2x Q5 Ultra II Master Mix | 25 µL | |
| NEBNext_i5 (20 µM) | 1.25 µL | |
| 112822_P7_anchor (20 µM) | 1.25 µL |
| A | B | C | D | E | F | |
| 98 °C | 98 °C | 71 °C | 72 °C | 72 °C | 4 °C | |
| 30 sec | 10 sec | 30 sec | 60 sec | 5 min | remaining |
Repeat step B-D for the determined optimal cycles.
Amplified Library sequence: ~340-400bp
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT NNNNNggaaaggacgaaacaccg GGCTGCGAGCATGGGGCCCGTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGCAATTTCCAGCCggcGGGCCCCATGCTCGCAGCCGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAATTTTTTGAGGCTGCGAGCATGGGGCCCTGGGGCTGGAAATTGCTTGAGCG
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG
PCR purify PCR2 onto 1 column each. Elute in 50 µl of EB buffer.
Tapestation
Use D1000 tapescreen only, make sure to use D1000 ladder and buffer. In PCR tubes: Add 3 uL of buffer + either 1 uL of ladder or sample
Pooling sampling based on nM from Tapestation into a single tube
Pooling Calculation:
[(desired read per sample)/(desired total read across all samples)]/Tapestation nM*X000(Random number to get a reasonably pipettable amount)
SPRI bead Purification: to remove any undesirable bands (eg primer dimers) observed
on gel. Make a pool of sample, mix well, take ½ for SPRI bead purification. Add dH2O or EB up
to 50 uL. Perform 0.80X bead purification (add 40 uL beads to pool) because product is ~340-400 bp. Elute from beads with 20 µl EB buffer.
Next Generation Sequencing
Collect >400 average reads per library member to be safe (so for 6,000-member library, aim for >2.5M reads).
Read 1: 150 nt
Read 2: 150 nt
Index 1: 8 nt
Index 2: 8 nt