Aug 26, 2025
LAMP-PCR targeting HSP70 for screening Chagas disease
- Sneider Gutierrez1,
- Jessy Condori2,
- Shirley Equilia3,
- Edith Malaga2,
- Jean Karla Velarde3,
- Luciana Basma4
- 1Johns Hopkins University Bloomberg School of Public Health, Baltimore, MD, USA.;
- 2Universidad Peruana Cayetano Heredia, Lima, Perú.;
- 3Asociación Benéfica Prisma (PRISMA). Lima, Perú;
- 4Universidad Católica Boliviana San Pablo. Santa Cruz, Bolivia
External link: https://doi.org/10.1128/spectrum.00172-25
Protocol Citation: Sneider Gutierrez, Jessy Condori, Shirley Equilia, Edith Malaga, Jean Karla Velarde, Luciana Basma 2025. LAMP-PCR targeting HSP70 for screening Chagas disease. protocols.io https://dx.doi.org/10.17504/protocols.io.e6nvwbpqzvmk/v1
Manuscript citation:
Guarnizo SAG, Condori BJ, Basma L, Equilia S, Malaga E, Defazio S, Arteaga E, Velarde JK, Obregón M, Takyar A, Duque C, Hakim J, Tinajeros F, Gilman RH, Bowman N, Mugnier MR A specific, stable, and accessible LAMP assay targeting the HSP70 gene of Trypanosoma cruzi. Microbiology Spectrum 13(11). doi: 10.1128/spectrum.00172-25
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: October 26, 2024
Last Modified: August 26, 2025
Protocol Integer ID: 110962
Keywords: T. cruzi, LAMP-PCR, Hsp70, Chagas disease, diagnosis, hsp70 gene, screening chagas disease, chagas disease the loop, targeting hsp70, pcrtchsp70 assay, leishmania spp, gene id
Abstract
The Loop-mediated isothermal amplification LAMP-PCRTcHSP70 assay described here targets the HSP70 gene of T. cruzi (Gene ID: TcCLB.511211.170). It has been designed to identify multiple T. cruzi lineages without cross-reacting with T. rangeli or Leishmania spp.
Guidelines
LAMP-PCRTcHSP70 assay can be run using Sybr green or using the Cas12a system.
Materials
- 1.5 mL vials
- 8-vial 0.2 mL PCR strips
- 1.5 mL racks
- 0.2 mL racks
- 1000
µL tips - 200
µL tips - 20
µL tips - 10
µL extra -ong tips - Thermo block compatible with PCR tubes (eg. Benchmark BSH1002 Corning LSE digital dry bath heater with block 6 x 0.2 mL Strips)
- 1.5 mL and 0.2 mL tubes spinner (eg. Benchmark C1012 MyFuge12 Mini Centrifuge CN Z742583)
- Vortex
- Phone camera
- Blue LED lamp (only when using Cas12a system)
Troubleshooting
Safety warnings
- Do not open amplified products in the area where the master mix is prepared or DNA is seeded.
Before start
- Make sure all materials and reagents are available and prepared as described in the reagent preparation section
- Thaw the DNA samples in advance and keep them at 4°C.
Reagents list
List of reagents required for the LAMP-PCR TcHSP70 assay. Some reagents are essential, while others are exclusively needed when integrating the Cas12a system.
Primers for the LAMP-PCRTcHSP70 assay:
| A | B | C | D | E | F | G | H | |
| Primer | Label | Sequence 5-3’ | Primer length | Purification method | DNA Oligo | Essential | ||
| TcH_1 | FIP (F1c-F2) | TCGCGCTGTTCCTTGTCCTGCG GCCTGAGCAAGGCGGACATTG | 43 | Standard Desalting | 25 nmole | Yes | ||
| TcH_2 | BIP (B1c-B2) | CGGTCTTGAGAACTACGCATTTTCGTGTCGGCCTCCTCAATCTTG | 45 | Standard Desalting | 25 nmole | Yes | ||
| TcH_3 | F3 | AAGCGCAACCAGATTGTCATCACG | 24 | Standard Desalting | 25 nmole | Yes | ||
| TcH_4 | B3 | TCCACGGCACTCGTAATCGTGT | 22 | Standard Desalting | 25 nmole | Yes | ||
| TcH_5 | FL | CTTGGCAGCCTCGGACACCA | 20 | Standard Desalting | 25 nmole | Yes | ||
| TcH_6 | BL | TAAACGAGCCGAACGTCGC | 19 | Standard Desalting | 25 nmole | Yes |
General reagents for LAMP-PCRTcHSP70 assay
| A | B | C | D | E | |
| Reagent | Concentration | Privider | Catalog number | Essential | |
| Ultrapure H2O | NA | Sigma Aldrich | W4502 | Yes | |
| Deoxynucleotide (dNTP) Solution Mix | 10mM | New England Biolab | N0447S | Yes | |
| Magnesium Sulfate (MgSO4) Solution | 100mM | New England Biolab | B1003S | Yes | |
| Betaine | 5M | Sigma Aldrich | B0300-5VL | Yes | |
| Isothermal Amplification buffer | 20mM | New England Biolab | B0537S | Yes | |
| Bst 2.0 DNA Polymerase - 8000 units | 10X | New England Biolab | M0537L | Yes | |
| SYBR™ Green I Nucleic Acid Gel Stain - 10,000X concentrate in DMSO. Catalog number: S7563 | 10,000X | Thermo Fisher Scientific | S7563 | Yes |
Reagents for LAMP-PCRTcHSP70 assay coupled to Cas12a system
| A | B | C | D | E | |
| Reagent | Concentration | Privider | Catalog number | Essential | |
| NEBuffer™ r2.1 | 10 X | Nee England Biolabs | B6002S | Only for Cas12a system | |
| Alt-R™ L.b. Cas12a (Cpf1) Ultra | 100 µg | IDT | na | Only for Cas12a system | |
| ssDNA probe: /56-FAM/TTATTATT/3IABkFQ/ | 250 nmole DNA Oligo | IDT | customized | Only for Cas12a system | |
| Alt-R™ L.b. Cas12a crRNA, Standard Desalting IE HPLC Purification* | 10 nmol | IDT | customized | Only for Cas12a system | |
| RNAase Inhibitor | 20 U/ µl | Thermo Fisher Scientific | FIC-N8080119 | Only for Cas12a system | |
| Mineral oil | na | Sigma Aldrich | M8662 | Only fo Cas12a system |
* Alt-R‱ L.b. Cas12a crRNA sequence: /AlTR1/rUrArArUrUrUrCrUrArCrUrArArGrUrGrUrArGrArUrCrGrUrCrArArUrGrCrGrCrUrCrGrCrGrCrUrGrU/AlTR2/
Reagents preparation
Preparing Reagent Stock Solutions: Reagents not described here do not require additional preparation.
Primer Preparation
- Spin down lyophilized primers (SG11-SG16) for 3 minutes at 1000xg.
- Resuspend primers at a concentration of 100 µM in ultrapure H₂O.
- Vortex for 5 seconds.
- Take 100 µL of the 100 µM stock solution and dilute it with 900 µL of ultrapure water to prepare a 10 µM stock solution.
- Vortex for 5 seconds.
- Spin down.
- Prepare 200 µL aliquots of each individual primer at 10 µM to avoid multiple freeze-thaw cycles.
- Store at -20°C until use.
Preparing additional reagents for LAMP-PCRTcHSP70 assay
Diluting SYBR‱ Green I Nucleic Acid Gel Stain - 10,000X
- Prepare a dilution of 1:10 in molecular water.
- Vortex for 5 seconds.
- Make aliquots of 200µL.
- Store aliquots protected from light at -20°C until use
Preparing additional reagents for LAMP-PCRTcHSP70 assay coupled to the Cas12a system
Reconstitution of Alt-R‱ L.b. Cas12a (Cpf1) Ultra
- The Alt-R‱ L.b. Cas12a is provided in solution at 10 µg/µL. 100 µg of LbCas12a Ultra nuclease = 670 pmol, equivalent to an initial concentration of 67 µM.
- For each 10 uL of 67 µM Cas12a add 660 of ultrapure H2O to prepare a 1 µM stock solution.
- Vortex for 5 seconds.
- Store at -20°C until use.
Reconstitution of ssDNA probe: /56-FAM/TTATTATT/3IABkFQ/ 250 nmol
- Spin down the lyophilized sDNA probe for 3 minutes at 1000xg.
- Add 392 µL of ultrapure water to the lyophilized ssDNA probe to make a 100 µM stock solution. Mix well to ensure complete dissolution.
- To prepare a 10 µM working stock, dilute the 100 µM stock solution by adding 10 µL of the 100 µM solution to 90 µL of ultrapure water.
- Prepare 10 µL aliquots of the 10 µM working stock.
- Store aliquots protected from light at -20°C until use.
Reconstitution of Lyophilized crRNA: Alt-R‱ L.b. Cas12a crRNA, 10 nmol
- Spin down lyophilized crRNA for 3 minutes at 1000xg.
- Add 1 mL of ultrapure water to the lyophilized crRNA to make a 10 µM stock solution. Vortex for 5 seconds.
- Take 100 µL of the 10 µM stock solution and dilute it with 900 µL of ultrapure water to prepare a 1 µM working solution.
- Aliquot 100 µL of the 1 µM solution into separate tubes.
- Store aliquots at -20°C until use, or at -80°C for long-term storage.
RNAase Inhibitor at 20 U/µL
- Prepare aliquots of 50 uL to avoid multiple thawing cycles.
- Store aliquots at -20°C until use.
Preparing the master mix
Thaw all reagents at room temperature except by the enzymes and gRNA.
Mix the reagents at room temperature as described in the following table:
| A | B | C | D | |
| Primer ID | Work concentration | Stock concentration | µL for 1 reaction | |
| Primer SG_11-FIP | 40 pmol | 10 µM | 4 | |
| Primer SG_12-BIP | 40 pmol | 10 µM | 4 | |
| Primer SG_13-F3 | 5 pmol | 10 µM | 0.5 | |
| Primer SG_14-B3 | 5 pmol | 10 µM | 0.5 | |
| Primer SG_15-LF | 5 pmol | 10 µM | 0.5 | |
| Primer SG_16-LB | 5 pmol | 10 µM | 0.5 | |
| Betaine | 1M | 5M | 5 | |
| Ultrapure H2O | NA | NA | 3.38 | |
| Isothermal amplification buffer | 1X | 10X | 2.52 | |
| Bst pol 2.0 | 8U | 8,000 units/ml | 1 | |
| MgSO4 | 0.8mM | 100mM | 0.8 | |
| dNTPs | 2.5mM | 10 mM | 0.5 |
Vortex the mix for 3 seconds
Spin down
Aliquot 23 µL of the master mix per vial of 0.2 mL and use immediately or store it at -20°C for up to 8 months until use.
Note: It is recommended to use 8-vial 0.2 mL PCR strips, as they facilitate taking pictures for tube alignment. To make tube handling easier, it is also recommended to use scissors to cut them into sets of four vials. This facilitates opening and closing the tubes when loading SYBR Green and DNA.
When using the Cas12a system instead of SYBR Green
Prepare the Cas12a-gRNA complex by mixing the reagents described in the following table:
| A | B | C | |
| Reagent | Stock concentration | µL for 1 reaction | |
| NEB Buffer r2.1 | 10x | 4 | |
| gRNA | 1 uM | 2.5 | |
| lbCas12a | 1 uM | 2.5 | |
| ssDNA probes | 10 uM | 3 | |
| RNAase Inhibitor | 4U/uL | 0 | |
| Water | n/a | 8 |
Incubate the mix at 37 °C for 40 minutes to generate the Cas12a-gRNA complex
DNA loading
- To 23 µL of the previously prepared master mix, add 2 µL of DNA and mix by pipetting ten times.
The DNA seeding can be performed at room temperature when using the Bst2 polymerase.
- Replace the DNA template with 2 µL of ultrapure water for the negative control.
- Replace the DNA template with 2 µL of positive control (DNA extracted from T. cruzi)
When using SYBR green for visualization:
- Add 2 µL of 1:10 diluted SYBR Green I fluorescent dye to the lid of the tube.
- Carefully close the tube.
- Proceed to the incubation section.
When using the Cas12a system for visualization:
- Add 35 µL of mineral oil.
- Add 20 µL of the Cas12a-gRNA complex to the lid of the tube.
- Carefully close the tube.
- Proceed to the incubation section.
Incubation
Incubation time changes depending on the visualization method
When using SYBR green for visualization:
- Incubate the reaction at 65 °C for 60 min.
When using the Cas12a system for visualization:
- Incubate the reaction at 65 °C for 40 min.
- Spin down the reaction mixture for 5-10 seconds to combine Cas12a-gRNA complex and the LAMP reaction.
- Incubate again at 37 degrees C for 20 minutes.
Visualization
Two options for visualization
When using SYBR green for visualization:
- Spin down the incubated reaction and register the change of color from “brown” to “green” for positive amplification:
Figure 1. Visualization of LAMP-Amplified Products with the Naked Eye
When using the Cas12a system for visualization:
- Spin down the incubated reaction and visualize the tubes under LED blue light.
Figure 2. Visualization of LAMP-Amplified Products Using the Cas12a System and Blue LED Light
Agarose gel
- Before opening the tube inactivate the enzymes at 80°C for 10 minutes to stop the reaction.
Note: open the tubes in an area exclusively dedicated for electrophoresis.
- Mix 3 μL of the amplified products with 3 μL of 2X loading buffer.
- Load the mix on a 2% agarose gel, pre-stained with 0.2 μg/mL ethidium.
- Load 3 μL of 100 bp DNA Ladder for product size reference.
- Run the electrophoresis at 100V for 30-35 minutes
Figure 3. Amplification Products Visualized on Agarose Gel. No amplification (-). Positive amplification (+).
Protocol references
Ordóñez, D. et al. A Trypanosoma cruzi Genome Tandem Repetitive Satellite DNA Sequence as a Molecular Marker for a LAMP Assay for Diagnosing Chagas’ Disease. Dis. Markers 2020, 1–8 (2020)
Qin, C. et al. One-Pot Visual Detection of African Swine Fever Virus Using CRISPR-Cas12a. Front. Vet. Sci. 9, 962438 (2022).