Jun 17, 2025
LAMP-Blast: Easier method to blast LAMP primersets with NCBI's Blast
- David Aciole Barbosa1
- 1NIB - UMC
Protocol Citation: David Aciole Barbosa 2025. LAMP-Blast: Easier method to blast LAMP primersets with NCBI's Blast. protocols.io https://dx.doi.org/10.17504/protocols.io.n2bvjb4j5gk5/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: In development
We are still developing and optimizing this protocol
Created: May 31, 2025
Last Modified: June 17, 2025
Protocol Integer ID: 219239
Keywords: lamp, PCR, loop mediated, loop-medited, isothermal, isothermal amplification, loop, primer, primers, specificity, non target, non-target, cross-species, cross species, cross-amplification, amplicon, loop amplicon, lamplicon, lamp primers specificity, lamp primerset, blast, lamp, primer
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK
The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
LAMP-blast is a method to make LAMP primers specificity check easier and faster.
Troubleshooting
Get primers
Get your LAMP primers or design them (many possible ways / software)
The example in this protocol uses SARS-COV2 primers from Rabe & Cepko, 2020 obtained from Lamp Bank (https://lampprimerbank-frontend-heiderlab-53b16a.pages.imims.de/)
Rabe BA, Cepko C. SARS-CoV-2 detection using isothermal amplification and a rapid, inexpensive protocol for sample inactivation and purification. Proc Natl Acad Sci U S A. 2020 Sep 29;117(39):24450-24458. doi: 10.1073/pnas.2011221117. Epub 2020 Sep 8. PMID: 32900935; PMCID: PMC7533677.
For convenience, they are expected to be in a fasta format with standardized header, like this:
[NAME] - [SET NUMBER] - [PRIMER NAME]
>name-setnumber-F3
TGCTTCAGTCAGCTGATG
>SARS_cov-set1992-F3
TGCTTCAGTCAGCTGATG
>SARS_cov-set1992-F2
TTAAATTGTCATCTTCGTCCTT
(...)
By default, individual primers follow the LAMP senseness;
F3, F2, B1, LB are sense; 5' - 3'
F1, B2, B3, LF are reverse-complementary; 3' - 5' (when compared to the F3 sequence, for instance)
Lamp-blast will automatically convert all primers to 5' - 3'
Otherwise, use lamp-blast-all_sense.sh script
If your primers are not individual nor in fasta format, please leave a comment in the github page issues
Convert the primers to lamp-blast format
Convert the primers using the lamp-blast.sh script (https://github.com/Aciole-David/lamp-blast) lamp-blast tool convertion tool
The tool expects the all primers are individual, not FIP - BIP format
Right: F3, F2, F1, B1, B2, B3, LF, LB
Wrong: F3, FIP, BIP, B3, LF, LB
The order is not important
Your sequence will look like this:
>SARSCoV2_NC_045512_2-set06
CGGTGGACAAATTGTCACNNCTGTGCAAAGGAAATTAAGGAGNNAGTGTTCAGACATTCTTTAAGCTTGTAANNATAAATTTTTGGCTTTGTGTGCTGANNTATTGGTGGAGCTAAACTTAAAGCCNNTTGAATTTAGGTGAAACATTTGTCACGNNCACTCAAAGGGATTGTACAGNNAAGTGTGTTAAATCCAGAGAAG
You can copy the sequence above as a test query
NCBI Blast search using lamp-blast format
Paste the converted primers sequence in the query formEnter the converted lamp primers sequence in the NCBI blast (blastn)
Paste the converted query sequence
OPTIONAL: You can add filters to refine the blast search
That will depend on what you wish to know;
Non-targets, related species, etc...
Optional: add filters
Select "Somewhat similar sequences (blastn)"
Change the blast program
Open the algorithm parameters option
Open algorithm parameters
Change general parametersSet "Max target" sequences to a number you find reasonable.
Recommended not too many so we can better view the results
Otherwise, go back to step 6 and change the filters
Set "Expected threshold" to 1000
Set "Word size" to 7
Change general parameters
Uncheck "Low complexity regions"
Uncheck "Low complexity regions"
Click the BLAST button
Press BLAST
Lamp-blast BLAST results
On results page, click "Query Cover" to reorder results by coverage on query sequence
Reorder results
OPTIONAL: Filter results
Filters are available if one wish to include or exclude some of the resultsOptionally add filters to the results pageusein
Optionally use filters in the results page
OPTIONAL: Download all results
If the query is composed of more than one query, use the "Download all" link to get the results in different formats
Optionally "Download all" results
Optional: Download results
Use the "Download" button in the section "Sequences producing significant alignments" to get the current results in different formats
Download current results
Optional: Select a portion of the hits before visualizing
One can uncheck the "select all"
Then, select certain hits
As a shortcut:
- - - Unchek the "select all"
- - - Check the first result
- - - Hold the SHIFT key
- - - Scroll down until you find a certain hit with a low e-value / cov / etc;
this will limit the number of results in the view step to be between the first (top) result until the last selected result
- - - check the last hit you wish to see in the viewer
The image below, for example, shows we'll (arbitrarily) limit to see only:
the best results (100% query cover / 7e-67 e-value / 89.86% identity)
down to
not good results (21% query cover / 587 e-value / 80.49% identity)
Best results
Not so good results
MSA viewer of results
Open MSA viewer
Use the Multiple Sequence Alignment (MSA) viewer
MSA on all hits
To see a MSA for all the hits, without any filter, click the MSA viewer button next to
"Other reports Distance tree of results"
MSA viewer button of all results
MSA on selected hits
To see a MSA for the selected hits, click the MSA viewer button in the rightmost of
"Sequences producing significant alignments" area
The image below shows the example from step 16
MSA viewer button of selected results
The MSA viewer page
MSA viewer shows a query-anchored alignment of hits, so the first sequence is the query
The query is the joined, converted primers, so you'll see all primers if they have a good overall match
Dark Intervals in the query are the 'NN'
The 'best' results are lightgrey
top 'best results'
Mismatches are highlighted red by default
Bottom 'not so good' results
The example shows that
'MZ937001.1 ', 'bat coronavirus' has only one mismatch around the position 100, while
'MZ064531.1', 'synthetic construct' has many mismatches and no F3 aligned
One would expect, therefore, that 'MZ937001.1' is more likely to potentially amplify than 'MZ064531.1' and all the results below the later one
'Potentially' because we know that other reasons (reagents, pipetting, dna input, etc) may reflect a good amplification
Nonetheless, we are able to see here which sequences are clearly expected to amplify or not amplify if both have the same reagents, preparation, etc
Optional: Tidy up the MSA page
Columns
Click the 'columns' button to select columns shown
This is different depending on which databases / hits you get
Optional: Select columns
Column width
Optional: Change the width of a column
Optional: Column width
Zoom in or out, in order to see many or few results
Download MSA results
One can download fasta or PDF of the results
More refined specificity check
If you want more control and be able to visualize much more results in a single specificity check,
consider using another tool of ours, LampAID: https://github.com/Aciole-David/lampAID
LampAID is easier to run, interpret and share results of lamp primer specificity
The tool can parallel direct searches of multiple primersets against thousands of sequences in minutes
LampAID results in a web browser
Paper is coming soon!
Protocol references
Aciole Barbosa, David (2025) Lamp-blast: Easier method to blast lamp primersets with NCBI’s blast, GitHub. Available at: https://github.com/Aciole-David/lamp-blast (Accessed: 16 June 2025).
ARABI-JESHVAGHANI, Fatemeh et al. LAMPPrimerBank, a manually curated database of experimentally validated loop-mediated isothermal amplification primers for detection of respiratory pathogens. Infection, v. 51, n. 6, p. 1809-1818, 2023.
Rabe BA, Cepko C. SARS-CoV-2 detection using isothermal amplification and a rapid, inexpensive protocol for sample inactivation and purification. Proc Natl Acad Sci U S A. 2020 Sep 29;117(39):24450-24458.
doi: 10.1073/pnas.2011221117. Epub 2020 Sep 8. PMID: 32900935; PMCID: PMC7533677.