Jul 07, 2023

Kompetitive Allele Specific PCR (KASP) with BioRad Software

  • Olivia E Todd1,
  • Eric L Patterson2
  • 1USDA-ARS Fort Collins, CO;
  • 2Colorado State University, Fort Collins, CO
Icon indicating open access to content
QR code linking to this content
Protocol CitationOlivia E Todd, Eric L Patterson 2023. Kompetitive Allele Specific PCR (KASP) with BioRad Software. protocols.io https://dx.doi.org/10.17504/protocols.io.dm6gpj9njgzp/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: December 19, 2022
Last Modified: November 08, 2023
Protocol Integer ID: 74213
Keywords: KASP, Primer design, Hex/Fam, PCR, kompetitive allele specific pcr, lgc genomics kasp master mix, using lgc genomics kasp master mix, biorad software, biorad analyzation software, primer design with hex, basic kasp protocol, pcr, kasp, primer design, primer, allele
Abstract
A short guide to primer design with HEX/FAM tags and a basic KASP protocol using LGC Genomics KASP master mix and BioRad analyzation software.
Attachments
Materials
Materials

  • KASP master mix
  • primer mix
Primer Design
Design regular primers over the mutation you wish to test.
Note
The primer sequence must include this mutation to be specific.

Copy and paste the FAM and HEX tags to your wild type and mutant alleles. Pay attention to which tag is which.

FAM tag: GAAGGTGACCAAGTTCATGCT
HEX tag: GAAGGTCGGAGTCAACGGATT
Example: IAA16 GG to RR mutation Primers in Bassia scoparia

Note
Order these sequences through your primer manager.
AB
Bs_IAA16_S_FP(Hex)GAAGGTCGGAGTCAACGGATT TGTTCTTCAGGACACAAGTTGTAGG
Bs_IAA16_R_FP(Fam)GAAGGTGACCAAGTTCATGCT TGTTCTTCAGGACACAAGTTGTAAA
Bs_IAA16_RPAGTTTGATCATCGGACGTCTTCTT
Remove 2x KASP master mix from freezer, place On ice (LGC Genomics, Beverly, MA, USA).
  • This volume of 432 µL contains KASP enzyme, buffer, cofactors, dNTPs.


Thaw primers; one reverse primer, two forward primers, each specific to a SNP and corresponding fluorophore.

Make primer mix:
AB
EACH forward primer18 μl
Reverse primer45 μl
H2O69 μl
Total primer mix150
Add 12 µL of primer mix to the 2x KASP tube, this now the KASP master mix.

Add 4 µL of KASP master mix to each sample well of a 96 well plate.

Add 4 µL of template DNA @ 5 ng/μl -20 ng/μl .

Include 3 NTCs, as well as appropriate controls.
Bio-Rad machine and software
Set up thermocycling conditions according to the protocol:
ABC
Step Temperature Length
1 94 C 15 minutes
2 94 C 20 seconds 
3 61 C 1 min
4 Go to step 2 10x
5 94 C 20 seconds
6 55 C 1 min
7 30 C 10 seconds
8 Go to 5 35x (take read each cycle)
Make sure that each well of the plate has both FAM and HEX fluorophores selected.
Click Start Run.
Analysis
On the “Allelic Discrimination” tab the relative florescence units (RFU) for FAM and HEX are displayed, these are used to make a call on the SNP(s) present in each sample.
This can be compared to the controls for identification of genotype or species.
Example output of allelic discrimination:
Y axis: wild type, X axis: mutant