Mar 11, 2025
  • 1School of Biomedical Sciences, LKS Faculty of Medicine, The University of Hong Kong, Hong Kong
  • Wei JIN: First and corresponding author
  • Zhongjun Zhou: Corresponding author
Icon indicating open access to content
QR code linking to this content
Protocol CitationWei JIN, Zhongjun Zhou 2025. IT-scATAC-seq. protocols.io https://dx.doi.org/10.17504/protocols.io.5jyl8d4wrg2w/v1
Manuscript citation:
The paper titled "Semi-automated IT-scATAC-seq profiles cell-specific chromatin accessibility in differentiation and peripheral blood populations." will be published on Nature Communications.
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working in many settings.
Created: February 28, 2025
Last Modified: March 11, 2025
Protocol  Integer ID: 123576
Keywords: Single-cell ATAC-seq, indexed Tn5, single-cell OMICS, detailed mapping of chromatin accessibility, indexed tn5 transposome, chromatin accessibility, chromatin, tn5 transposome, indexed tn5 tagmentation, cell atac, cost per cell, single cell, cell, based scatac, scatac
Funders Acknowledgements:
Innovation and Technology Commission of Hong Kong grant InnoHealth@HK, Theme-based Research Scheme
Grant ID: T13-602/21N
Guangdong High-level Hospital Construction Project
Grant ID: KJ012019517
Guangdong-Dongguan Joint Research Scheme Guangdong-Hong Kong-Macau Program
Grant ID: 2021B1515130004
Disclaimer
The distribution of this protocol is solely intended for non-commercial academic research purposes, and a patent (PCT/CN2024/106967) associated with it has been submitted.
Abstract
Single-cell ATAC-seq (scATAC-seq) allows for detailed mapping of chromatin accessibility but often faces challenges related to throughput, cost, and equipment demands. In this study, we introduce indexed Tn5 tagmentation-based scATAC-seq (IT-scATAC-seq), a semi-automated, economical, and scalable method that utilizes indexed Tn5 transposomes along with a three-round barcoding strategy. This workflow can prepare libraries for up to 10,000 cells in just one day, lowers the cost per cell to around $0.01, and preserves strong data resolution.
Image Attribution
Microsoft PPT and image J.
Guidelines
Semi-automated IT-scATAC-seq profiles cell-specific chromatin accessibility in differentiation and peripheral blood populations
Wei Jin1,2,3 #, *, Jingchun Ma3,#, Li Rong3,#, Shengshuo Huang3, Tuo Li4, Guoxiang Jin2, Zhongjun Zhou 1,2,3 *
1Pediatric Research Institute, Dongguan Children Hospital, Guangdong Medical University, Dongguan, China
2Medical Research Centre; Guangdong Cardiovascular Institute; Key Laboratory for Immune and Genetic Research of Chronic Nephropathy, Guangdong Provincial People’s Hospital, Guangdong Academy of Medical Sciences, Southern Medical University, Guangzhou, China
3School of Biomedical Sciences, LKS Faculty of Medicine, The University of Hong Kong, Hong Kong
4 Department of Endocrinology, Changzheng Hospital, Shanghai, China
* Correspondence: [email protected]  or [email protected]
#These authors contributed equally to this work
Materials
1) E. coli C3013 cells (NEB, C2527I)
2) Chitin resin (NEB, S6651S)
3) Digitonin (Sigma-Aldrich, D141-500MG)
4) AMPure XP (Agencourt, A63880)
5) Proteinase K (NEB, P8111S)
6) High-Fidelity 2X PCR Master Mix (NEB, M0494L)
7) Exo I (NEB, M0293S)
8) Echo Qualified 384-Well Polypropylene Microplate 2.0 (LabCyte, PP-0200)
9) Hard-Shell 384-well PCR plate (Bio-Rad, HSR4805)
10) 0.2 ml PCR tubes
11) 1.5 ml Eppendorf tubes
12) Eppendorf ThermoMixer
13) 384-well PCR thermal cycler
14) Magnetic rack (Thermofisher)
15) 1 mL pipette (Eppendorf)
16) 100 μL pipette (Eppendorf)
17) 20 μL pipette (Eppendorf)
18) 2.5 μL pipette (Eppendorf)
19) 15 mL tube
Buffer preparation
In-house prepared Tn5: 30µM

ATAC-Resuspension buffer (RSB): Mix 500µL 1 M Tris-HCl (pH 8.0), 100µL 5 M NaCl, 150µL 1 M MgCl2, and 49.25 ml H2O for 50 mL omni-ATAC RSB.

ATAC-RSB-Hypotonic buffer: Mix 960 µL ATAC-RSB buffer with 10µL 10% Tween 20, 10µL 10% NP40 and 10µL 1% Digitonin and 10µL proteinase inhibitor.

ATAC-RSB wash buffer: Mix 990 µLATAC-RSB buffer with 10µL 10% Tween20.

Resuspension buffer: Mix 330µL PBS, 10µL 10% Tween-20, 10µL 1% Digitonin, 50µL 10% BSA with 600µL H2O.

5xTAPS-DMF buffer: Mix 20µL 1M TAPS-NaOH pH 8.2, 25µL 1M MgCl2, 500µL DMF and 455µL H2O for 1 ml 5xTAPS-DMF buffer.

STOP buffer: 1xPBS buffer, 100mM EDTA, 0.5% BSA.

Lysis buffer: 0.2% SDS, 10mM Tris-HCl, 10mM NaCl. Mix 200µL 1 M Tris-HCl pH8.0, 40µL 5 M NaCl, 400µL 10% SDS and 19.4 ml ddH2O for 20 ml buffer, store at R.T. Freshly add 0.2 mg/ml Proteinase into lysis buffer and freeze the plate at-20oC after Echo distribution.
Indexed Tn5 assmbly and quality control
Dissolve the indexed adapters and Tn5 reverse adapters with annealing buffer (10 mM Tris-HCl pH 8.0, 50 mM NaCl, 2mM EDTA) to make 200µM stock.
Tn5-Rvep-CTGTCTCTTATACACATCT
Q501GGCGGTAGGCGTGCTCCTAGCGCTAGATGTGTATAAGAGACAG
Q502GGCGGTAGGCGTGCTCTCGATATCAGATGTGTATAAGAGACAG
Q503GGCGGTAGGCGTGCTCCGTCTGCGAGATGTGTATAAGAGACAG
Q504GGCGGTAGGCGTGCTCTACTCATAAGATGTGTATAAGAGACAG
Q505GGCGGTAGGCGTGCTCCGCTATGTAGATGTGTATAAGAGACAG
Q506GGCGGTAGGCGTGCTCTATCGCACAGATGTGTATAAGAGACAG
Q701CCAACACCCGTGCGCTGGTGAATATAGATGTGTATAAGAGACAG
Q702CCAACACCCGTGCGCTGACAGGCGCAGATGTGTATAAGAGACAG
Q703CCAACACCCGTGCGCTGCATAGAGTAGATGTGTATAAGAGACAG
Q704CCAACACCCGTGCGCTGTGCGAGACAGATGTGTATAAGAGACAG
Table 1. Sequences of Tn5 assembly associated adapters.
Prepare 15µLof individual Q5XX and Q7XX adapters with equal Tn5-reverse adapter in 200µL PCR tube and anneal in a thermocycler as follows: 98 °C for 10 min, and slowly cool down to 23 °C with −0.1 °C/s. Mix the annealed adapter with 100µL 30µM Tn5 and 70µL coupling buffer (100mM HEPES-NaOH, 500mM NaCl, 50% v/v Glycerol, 0.5mM EDTA, 2mM DTT), and incubate in thermomixer at 25°C, 1000 rpm for one hour. The indexed Tn5 transposome was prepared by mixing 20µL of the paired two Tn5-adapters with 80µL coupling buffer and the resulting Tn5 transposome complex were 5µM.

IT-ATAC-Index#1 Q501&Q701 IT-ATAC-Index#13 Q504&Q701
IT-ATAC-Index#2 Q501&Q702 IT-ATAC-Index#14 Q504&Q702
IT-ATAC-Index#3 Q501&Q703 IT-ATAC-Index#15 Q504&Q703
IT-ATAC-Index#4 Q501&Q704 IT-ATAC-Index#16 Q504&Q704
IT-ATAC-Index#5 Q502&Q701 IT-ATAC-Index#17 Q505&Q701
IT-ATAC-Index#6 Q502&Q702 IT-ATAC-Index#18 Q505&Q702
IT-ATAC-Index#7 Q502&Q703 IT-ATAC-Index#19 Q505&Q703
IT-ATAC-Index#8 Q502&Q704 IT-ATAC-Index#20 Q505&Q704
IT-ATAC-Index#9 Q503&Q701 IT-ATAC-Index#21 Q506&Q701
IT-ATAC-Index#10 Q503&Q702 IT-ATAC-Index#22 Q506&Q702
IT-ATAC-Index#11 Q503&Q703 IT-ATAC-Index#23 Q506&Q703
IT-ATAC-Index#12 Q503&Q704 IT-ATAC-Index#24 Q506&Q704
Table 2. Index number of Tn5 for IT-scATAC-seq.

Prepare 1 µL 300 ng/µL genomic DNA, 4 µL 5xTAPS-DMF buffer
(50 mM TAPS-NaOH pH 8.2, 25 mM MgCl2, 50% DMF), 13 µL H2O, 2 µL assembled Tn5.
Incubate at 55 ℃ for 10 min, then add 2 µL 10X STOP buffer (2% SDS,
40 mM EDTA) and quench at 37oC 15min to dissociate Tn5 from DNA. Add
5 µL 6x Loading dye and run 1.5% DNA gel. The majority of tagmentated DNA sizes
were less than 1,000bp, indicating the assembled transposases are qualified
for downstream experiments.

Step-by-step protocol.
Collect cells. For culture cells: Harvest the cells with digestion enzymes and wash with 1x PBS buffer in 1.5mL Low bond tube; for cryopreserved cells, thaw the cells quickly at 37 °C water batch and transfer to pre-warmed medium and centrifuge 1000g 5min, check the cell viability (>95%) and density, and wash with 1x PBS buffer in 1.5mL Low bond tube; for tissue dissected cells, 0.1-0.2% formaldehyde crosslinking at room-temperature for 10min is recommended.
Nuclei isolation by OmniATAC buffer. Discard the PBS and resuspend the cells (250,000 for 5 indexed transposition reactions) with 100µL ATAC-RSB-Hypotonic buffer, lyse on ice for 5min, add 1mL ATAC-RSB wash buffer and up and down 5 times before spinning down by 500g for 10min.
Indexed Tn5 tagmentation. Discard the buffer avoiding disrupt the nuclei, and resuspend with 100 µL 0.33X PBS containing 0.1% Tween 20 and 0.01% Digitonin. Aliquot 20 µL resuspended nuclei (50,000 nuclei) to five Low bond tubes, followed by adding 20µL 5×Tagmentation buffer and 5µL indexed Tn5. Record the used indexed Tn5 number, and gently pipetting up and down 10 times and perform the tagmentation assay on a thermomixer at 37 °C 850 rpm for 30min. Add 500 µL STOP buffer to stop the reaction for 5min on ice.
Sorting plate preparation. Distribute 350nL lysis buffer to each well using liquid handling system Echo 550. Spin down the lysis buffer 3,000g for 2min. The sorting plates can be prepared just before usage or frozen at -20°C for ready use.
Single nuclei sorting. Add 6µL 100 μg/µL DAPI to stain the tagmentated nuclei and transfer the nuclei to flow tubes for sorting. A non-stained nuclei can be prepared in parallel for DAPI negative calibration. Different index-tagmentated nuclei are sorted into the same well of 384-plate.  
NOTE: After sorting, the plates can be frozen at -20°C until lysis.
Nuclei lysis and 1st barcoded PCR. Spin down the sorted nuclei to lysis buffer and incubate at 37°C for 15min. Add 100 nL 10% Triton X-100 to quench the 0.2% SDS in lysis buffer. Add 25nL indexed H5XX and 25nL indexed H7XX, as well as 500nL NEB High-Fidelity 2X PCR Master Mix, to each well and spin down. The first PCR is carried out with 72°C 5min, 98 °C 30s; 12 cycles of 98 °C 20 s, 63°C 30s,72 °C 1min; 72 °C 5min, 4 °C hold.
H501ACTCTTTCCCTACACGACGCTCTTCCGATCTTAGATCGCGGCGGTAGGCGTGCTC
H502ACTCTTTCCCTACACGACGCTCTTCCGATCTCTCTCTATGGCGGTAGGCGTGCTC
H503ACTCTTTCCCTACACGACGCTCTTCCGATCTTATCCTCTGGCGGTAGGCGTGCTC
H504ACTCTTTCCCTACACGACGCTCTTCCGATCTAGAGTAGAGGCGGTAGGCGTGCTC
H505ACTCTTTCCCTACACGACGCTCTTCCGATCTGTAAGGAGGGCGGTAGGCGTGCTC
H506ACTCTTTCCCTACACGACGCTCTTCCGATCTACTGCATAGGCGGTAGGCGTGCTC
H507ACTCTTTCCCTACACGACGCTCTTCCGATCTAAGGAGTAGGCGGTAGGCGTGCTC
H508ACTCTTTCCCTACACGACGCTCTTCCGATCTCTAAGCCTGGCGGTAGGCGTGCTC
H509ACTCTTTCCCTACACGACGCTCTTCCGATCTCGTCTAATGGCGGTAGGCGTGCTC
H510ACTCTTTCCCTACACGACGCTCTTCCGATCTTCTCTCCGGGCGGTAGGCGTGCTC
H511ACTCTTTCCCTACACGACGCTCTTCCGATCTTCGACTAGGGCGGTAGGCGTGCTC
H512ACTCTTTCCCTACACGACGCTCTTCCGATCTTTCTAGCTGGCGGTAGGCGTGCTC
H513ACTCTTTCCCTACACGACGCTCTTCCGATCTCCTAGAGTGGCGGTAGGCGTGCTC
H514ACTCTTTCCCTACACGACGCTCTTCCGATCTGCGTAAGAGGCGGTAGGCGTGCTC
H515ACTCTTTCCCTACACGACGCTCTTCCGATCTCTATTAAGGGCGGTAGGCGTGCTC
H516ACTCTTTCCCTACACGACGCTCTTCCGATCTAAGGCTATGGCGGTAGGCGTGCTC
H701GACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCGCCTTACCAACACCCGTGCGCTG
H702GACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTAGTACGCCAACACCCGTGCGCTG
H703GACTGGAGTTCAGACGTGTGCTCTTCCGATCTTTCTGCCTCCAACACCCGTGCGCTG
H704GACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCTCAGGACCAACACCCGTGCGCTG
H705GACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGGAGTCCCCAACACCCGTGCGCTG
H706GACTGGAGTTCAGACGTGTGCTCTTCCGATCTCATGCCTACCAACACCCGTGCGCTG
H707GACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTAGAGAGCCAACACCCGTGCGCTG
H708GACTGGAGTTCAGACGTGTGCTCTTCCGATCTCCTCTCTGCCAACACCCGTGCGCTG
H709GACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGCGTAGCCCAACACCCGTGCGCTG
H710GACTGGAGTTCAGACGTGTGCTCTTCCGATCTCAGCCTCGCCAACACCCGTGCGCTG
H711GACTGGAGTTCAGACGTGTGCTCTTCCGATCTTGCCTCTTCCAACACCCGTGCGCTG
H712GACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCCTCTACCCAACACCCGTGCGCTG
H713GACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCATGAGCCCAACACCCGTGCGCTG
H714GACTGGAGTTCAGACGTGTGCTCTTCCGATCTCCTGAGATCCAACACCCGTGCGCTG
H715GACTGGAGTTCAGACGTGTGCTCTTCCGATCTTAGCGAGTCCAACACCCGTGCGCTG
H716GACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTAGCTCCCCAACACCCGTGCGCTG
H717GACTGGAGTTCAGACGTGTGCTCTTCCGATCTTACTACGCCCAACACCCGTGCGCTG
H718GACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGGCTCCGCCAACACCCGTGCGCTG
H719GACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCAGCGTACCAACACCCGTGCGCTG
H720GACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTGCGCATCCAACACCCGTGCGCTG
H721GACTGGAGTTCAGACGTGTGCTCTTCCGATCTGAGCGCTACCAACACCCGTGCGCTG
H722GACTGGAGTTCAGACGTGTGCTCTTCCGATCTCGCTCAGTCCAACACCCGTGCGCTG
H723GACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTCTTAGGCCAACACCCGTGCGCTG
H724GACTGGAGTTCAGACGTGTGCTCTTCCGATCTACTGATCGCCAACACCCGTGCGCTG
Table 3. The first round of PCR primers.
PCR purification and adapter removal. Added 6µL PB buffer (Qiagen) to each well using 24-well multichannel pipette, pooled the PCR product by inverting the plate and centrifuge to a container, followed by purification using MinElute column (Qiagen) through pumping and finally elute with 50µLnuclease-free H2O. The undesired fragments, primers and adapters were removed by Exo I digestion (NEB), 1.0x AMPure XP beads purification and eluted with 25µL nuclease-free H2O.
Truseq adapter addition by 2nd PCR. Prepare 23µL eluted 1st PCR product, 2µL 10µM Truseq T5XX/T7XX and 25µL NEB High-Fidelity 2X PCR Master Mix in 200µLPCR tube. The 2nd PCR is carried out following 98 °C 30s; 2-3 cycles of 98 °C 20s, 63°C 30s, 72 °C 1min; 72 °C 5min, 4 °C hold.

T501AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGACGC
T502AATGATACGGCGACCACCGAGATCTACACATAGAGGCACACTCTTTCCCTACACGACGC
T503AATGATACGGCGACCACCGAGATCTACACCCTATCCTACACTCTTTCCCTACACGACGC
T504AATGATACGGCGACCACCGAGATCTACACGGCTCTGAACACTCTTTCCCTACACGACGC
T505AATGATACGGCGACCACCGAGATCTACACAGGCGAAGACACTCTTTCCCTACACGACGC
T506AATGATACGGCGACCACCGAGATCTACACTAATCTTAACACTCTTTCCCTACACGACGC
T507AATGATACGGCGACCACCGAGATCTACACCAGGACGTACACTCTTTCCCTACACGACGC
T508AATGATACGGCGACCACCGAGATCTACACGTACTGACACACTCTTTCCCTACACGACGC
T701CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTGT
T702CAAGCAGAAGACGGCATACGAGATTCTCCGGAGTGACTGGAGTTCAGACGTGT
T703CAAGCAGAAGACGGCATACGAGATAATGAGCGGTGACTGGAGTTCAGACGTGT
T704CAAGCAGAAGACGGCATACGAGATGGAATCTCGTGACTGGAGTTCAGACGTGT
T705CAAGCAGAAGACGGCATACGAGATTTCTGAATGTGACTGGAGTTCAGACGTGT
T706CAAGCAGAAGACGGCATACGAGATACGAATTCGTGACTGGAGTTCAGACGTGT
T707CAAGCAGAAGACGGCATACGAGATAGCTTCAGGTGACTGGAGTTCAGACGTGT
T708CAAGCAGAAGACGGCATACGAGATGCGCATTAGTGACTGGAGTTCAGACGTGT
T709CAAGCAGAAGACGGCATACGAGATCATAGCCGGTGACTGGAGTTCAGACGTGT
T710CAAGCAGAAGACGGCATACGAGATTTCGCGGAGTGACTGGAGTTCAGACGTGT
T711CAAGCAGAAGACGGCATACGAGATGCGCGAGAGTGACTGGAGTTCAGACGTGT
T712CAAGCAGAAGACGGCATACGAGATCTATCGCTGTGACTGGAGTTCAGACGTGT
Table 4. Sequences of TrueSeq primers.
Library purification and NGS. Purify the library via AMPure XP beads double selection (0.50x/0.35x) to remove primer dimers and large size fragments, and elute with 20-40µL nuclease-free H2O. The concentration is quantified with Qubit 4.0 and we usually get 5-50 ng/µL (cell-context dependent) of the final library and sent for NGS.
Library quality control

Figure 1.DNA electrophoresis of IT-scATAC-seq library.



Figure 2.Representative of fragments distribution from a good IT-scATAC-seq library.

Protocol references
The Tn5 purification and assembly refers to Picelli, S. et al. Tn5 transposase and tagmentation procedures for massively scaled sequencing projects. Genome Res 24, 2033-40 (2014).
Acknowledgements
We thank the workshop on single-cell omics in 2019 provided by Professor He Aibin’s lab at Peking University.
We thank the HKU core facility for the equipment of Flow Cytometry and Liquid Handler.