Apr 01, 2026
Investigation of six-week DNA degradation patterns in tissue exposed to indoor and outdoor conditions using FTA™ Cards
- Yatry Krushnalal Patel1,
- Nammi Lekhana Nammi1,
- Shrusti Ramesh Mane1,
- Desire Lee Dalton1
- 1School of Health and Life Sciences, Teesside University, Middlesbrough, TS1 3BX, United Kingdom
Protocol Citation: Yatry Krushnalal Patel, Nammi Lekhana Nammi, Shrusti Ramesh Mane, Desire Lee Dalton 2026. Investigation of six-week DNA degradation patterns in tissue exposed to indoor and outdoor conditions using FTA™ Cards. protocols.io https://dx.doi.org/10.17504/protocols.io.q26g7o7xkvwz/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: March 31, 2026
Last Modified: April 01, 2026
Protocol Integer ID: 314179
Keywords: DNA extraction, FTA cards, Tissue, week dna degradation patterns in tissue, downstream mitochondrial dna analysis, week dna degradation pattern, degradation in outdoor sample, beef tissue sample, extracted dna, dna extraction, mitochondrial cytochrome, dna persistence, amplifiable dna recovery, upper temporal limits of amplifiable dna recovery, evidence collection under varied environmental condition, bp fragment of the mitochondrial cytochrome, understanding of dna persistence, agarose gel electrophoresi, performance of qiacard fta elute card, exposed tissue
Abstract
This study examined six‑week DNA degradation patterns in animal tissue exposed to contrasting environmental conditions and assessed the performance of QIAcard FTA Elute cards for downstream mitochondrial DNA analysis. Beef tissue samples were deposited onto ceramic tiles and placed either indoors or outdoors for four exposure intervals (Day 0, 1 week, 3 weeks, and 6 weeks). At each interval, tissue was transferred to FTA cards using a standardized 6 mm punch with controlled pressure to ensure consistent sample deposition. DNA extraction followed the QIAcard FTA Elute protocol, including sequential TE buffer washes and Proteinase K digestion prior to elution. Extracted DNA was amplified targeting a 148 bp fragment of the mitochondrial cytochrome b gene using primers L15601 and H15748, and amplification success was evaluated by agarose gel electrophoresis. All samples were successfully extracted from FTA cards, and PCR amplification was achieved for all indoor‑ and outdoor‑exposed tissues. Although factors such as UV exposure, moisture, and temperature variation were expected to accelerate degradation in outdoor samples, no detectable reduction in amplification success was observed across the six‑week period. Further comparative analysis across extended time points is needed to define the upper temporal limits of amplifiable DNA recovery from environmentally exposed tissue collected on FTA cards. Overall, these findings enhance understanding of DNA persistence in forensic settings and support the reliability of FTA‑based evidence collection under varied environmental conditions.
Guidelines
Note that this protocol requires approval by the users' Institutional Animal Care and Use Committee (IACUC) or equivalent ethics committee since tissue samples are being used.
Materials
**Beef
**Primers:**
L15601: TACGCAATCCATCGATCAATTCC + H15748: GGTTGTCCTCCAATTCATGTT
**QIAcard™ FTA™ Elute Micro Cards
**QIAcard™ FTA™ Elute Buffer
**TE Buffer (10 mM Tris-HCl, 0.1 mM EDTA)
**Proteinase K
**GoTaq® G2 Colorless Master Mix
**Nuclease-Free Water
**Agarose
**TBE Buffer (1x)
**SYBR™ Safe DNA Gel Stain
**Loading Buffer (5x)
**Consumables and equipment**
Heating block
Heating plate
Centrifuge
Vortex
Thermal cycler
Parafilm
Weight: 0.8 to 1 kg
**PCR tubes
**1.5 ml tubes
**Sterile punch (6 mm)**
**Pipette tips**
**Gel tray, combs, electrophoresis tank**
**Gel documentation system**
**Erlenmeyer flask**
Troubleshooting
Safety warnings
IMPORTANT:
If the punches are left in TE buffer too long, the sample can potentially be compromised. Therefore, when processing more than two samples, we recommend processing only two samples at a time.
Methods
Cut a slice of tissue (beef) on a ceramic tile. Leave one tile outside and one tile inside for 6 weeks. Do the same at 3 weeks, 1 week and 1 day.
Moisten punch with 1 μL TE buffer.
Position punch over tissue; apply 0.8 kg weight for 5–10 s.
Use UV-sterilized parafilm between punch and weight, discard after use.
Leave tissue on card for 24 hours.
Place the QIAcard FTA Elute card on a cutting mat and cut one 6 mm punch from the FTA Elute Card and place into a 2 ml microcentrifuge tube.
IMPORTANT: Before continuing with the next step, read the instruction below carefully:
If the punches are left in TE~4 buffer too long, the sample can potentially be compromised. Therefore, when processing more than two samples, we recommend processing only two samples at a time for step 3–6: process only the first two samples, and then process the next batch of two samples and continue processing samples in sets of two. Once the first wash is completed for all samples, proceed with the next wash (step 7) in sets of two samples until all samples are ready for step 8.
Pipette 500 μl TE buffer into the microcentrifuge tube containing the punches.
Close the microcentrifuge tube and vortex for 5 s. Ensure the punches move up into the center of the microcentrifuge tube when they are vortexed.
Briefly centrifuge the microcentrifuge tubes to remove any excess liquid from the cap.
Remove excess TE buffer and discard.
Repeat above steps for a total of two to three washes with TE buffer.
Pipette 100 μl of QIAcard FTA Elute Buffer and 6 μl Proteinase K into the microcentrifuge tube containing the sample punch.
Place the microcentrifuge tube on a heated mixer or shaker at 60°C (Proteinase K digestion) for 25 min at 1000 rpm.
For inactivation of Proteinase K, place the microcentrifuge tube on a heated mixer or shaker at 95°C (Proteinase K inactivation) for 5 min at 1000 rpm.
After incubation, briefly centrifuge the microcentrifuge tube to remove any excess liquid from the cap.
Spin at maximum speed for 2 min. Discard the punches and proceed with quantification and/or amplification.
Prepare 25 μL PCR mix
Agarose Gel
To make a 1.2% solution you will need 0.8 g of agarose and 60 ml of 1x TBE electrophoresis buffer.
Add 0.8 g of agarose powder to a suitable container (e.g., Erlenmeyer flask).
Add 60 ml 1x TBE electrophoresis buffer and DO NOT swirl - put straight on hotplate, swirl to mix once it is boiling to suspend the agarose powder in the buffer.
Heat the mixture to boiling while occasionally swirling the mixture.
With the small flask still in place, set aside the agarose to cool to 60°C before pouring gels.
Add 6 μl SYBR™ Safe DNA Gel Stain and swirl to mix.
Pour the mixture into the electrophoresis unit and allow the gel to set (20 to 30 minutes).
In a new tube, transfer 2 μl of 5x loading dye into 10 μl PCR product. Pipet up and down to mix.
Load 10 μl of the samples into wells of the gel.
Electrophorese your samples at 150 V for 30 minutes.
Capture gel image using a gel documentation system.