Aug 17, 2020
Version 2
INSIGHT: a population scale COVID-19 testing strategy combining point-of-care diagnosis with centralised high-throughput sequencing V.2
This protocol is a draft, published without a DOI.
- Qianxin Wu1,
- Chenqu Suo1,2,
- Tom Brown3,
- Tengyao Wang4,
- Sarah Teichmann1,5,
- Andrew Bassett1
- 1Wellcome Sanger Institute, Wellcome Genome Campus, Hinxton, Cambridge CB10 1SA, UK;
- 2Department of Paediatrics, Cambridge University Hospitals, Hills Road, Cambridge CB2 0QQ, UK;
- 3Department of Chemistry, University of Oxford, Chemistry Research Laboratory, 12 Mansfield Road, Oxford OX1 3TA UK;
- 4Department of Statistical Science, University College London, 1-19 Torrington Place, London WC1E 7HB, UK;
- 5Department of Physics/Cavendish Laboratory, University of Cambridge, JJ Thomson Ave., Cambridge CB3 0HE, UK
- Coronavirus Method Development Community
- XPRIZE Rapid Covid Testing
Protocol Citation: Qianxin Wu, Chenqu Suo, Tom Brown, Tengyao Wang, Sarah Teichmann, Andrew Bassett 2020. INSIGHT: a population scale COVID-19 testing strategy combining point-of-care diagnosis with centralised high-throughput sequencing. protocols.io https://protocols.io/view/insight-a-population-scale-covid-19-testing-strate-bjrikm4eVersion created by Chenqu Suo
Manuscript citation:
https://doi.org/10.1101/2020.06.01.127019
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: August 14, 2020
Last Modified: September 02, 2020
Protocol Integer ID: 40458
Abstract
We present INSIGHT (Isothermal NASBA-Sequencing-based hIGH-througput Test): a two-stage COVID-19 testing strategy, using a barcoded isothermal NASBA reaction that combines point-of- care diagnosis with next generation sequencing, aiming to achieve population-scale COVID-19 testing. INSIGHT combines the advantages of near-patient with centralised testing. Stage 1 allows a quick decentralised readout for early isolation of pre-symptomatic or asymptomatic patients. The same reaction products can then be used in a highly multiplexed sequencing-based assay in Stage 2, confirming the near-patient testing results and facilitating centralised data collection. Based on experiments using commercially acquired human saliva with spiked-in viral RNA as input, the INSIGHT platform gives Stage 1 results within one to two hours, using either fluorescence detection or a lateral flow (dipstick) readout, whilst simultaneously incorporating sample-specific barcodes into the amplification product. INSIGHT Stage 2 can be performed by directly pooling and sequencing all post-amplification barcoded Stage 1 products from hundreds of thousands of samples with minimal sample preparation steps. The 95% limit of detection (LoD-95) for INSIGHT is estimated to be below 50 copies of viral RNA per 20 μl of reaction. Our two-stage testing strategy is suitable for further development into a rapid home-based and point-of-care assay, and is potentially scalable to the population level.
Materials
MATERIALS
QuickExtract DNA Extraction SolutionLucigenCatalog #QE09050
NASBA liquid kitLife Sciences Advanced Technologies Inc.Catalog #SKU: NWK-1
Tris (1 M) pH = 8 RNase freeInvitrogen - Thermo FisherCatalog #AM9855G
Sodium Hydroxide Sigma-aldrichCatalog #71687
1M MgCl2Invitrogen - Thermo FisherCatalog #AM9530G
2M KClInvitrogen - Thermo FisherCatalog #AM9640G
DTT Sigma-aldrichCatalog #43816
DMSOSigma-aldrichCatalog #276855
dNTP set 100 mMInvitrogen - Thermo FisherCatalog #10297018
NTP set 100 mMThermo ScientificCatalog #R0481
RNase HNEBCatalog #M0297L
ProtoScript II reverse transcriptaseNEBCatalog #M0368S
T7 RNA polymerase NEBCatalog #M0251L
BSA 20 mg/mlNEBCatalog #B9000S
PCRD lateral flow assayAbingdon HealthCatalog #FG-FD51673
Qubit RNA HS Assay KitInvitrogen - Thermo FisherCatalog #Q32852
PowerUp™ SYBR™ Green qPCR Master MixApplied BiosystemsCatalog #15340939
Twist synthetic SARS-CoV-2 RNA controlTwist BioscienceCatalog #Mt007544.1
NASBA lyophilised kitLife Sciences Advanced Technologies Inc.Catalog #SKU: NLK
Qubit dsDNA HS Assay KitInvitrogenCatalog #Q32851
Normal human salivaMyBioSourceCatalog #MBS170210
QIAquick PCR Purification KitQiagenCatalog #28104
KAPA HiFi HotStart ReadyMix PCR KitKapa BiosystemsCatalog #KK2600
AMPure XPBechman CoulterCatalog #A63882
MiSeq Reagent Kits v2 (300-cycles) illuminaCatalog #MS-102-2002
NASBA primers (P8) sequence:
| FWD primer | CCAGCAACTGTTTGTGGACCTA | |
| REV primer with T7 handle | aattctaatacgactcactatagggagaaggACACCTGTGCCTGTTAAACCAT | |
| FWD primer with 5-nt barcode and Illumina handle | tgactggagttcagacgtgtgctcttccgatctnnnnnCCAGCAACTGTTTGTGGACCTA | |
| REV primer with 5-nt barcode and T7 handle | aattctaatacgactcactatagggagaaggnnnnnACACCTGTGCCTGTTAAACCAT |
Toehold molecular beacon (2'-O-methyl RNA):
FAM-AUUGACAGUCUACUAAUUUGGUUAAAAACAAAUGUGUCAA-BHQ1dT-UUCAACUUCAAUG-propyl
P8 RNA capture oligos for PCRD:
| Probe A | FAM-AAAAGTCTACTAATTTGGTTAAAA | |
| Probe B | ACAAATGTGTCAATTTCAACTTCA-Biotin |
Library construction PCR primers:
| P5 end primer | AATGATACGGCGACCACCGAGATCTACACNNNNNNNNAGCCAGCTCTGGAGAATTCTAATACGACTCACTATAGGGAGAAGG | |
| P7 end primer | CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT | |
| Customised NGS primer (T7containing) | AGCCAGCTCTGGAGAATTCTAATACGACTCACTATAGGGAGAAGG |
Safety warnings
*** IMPORTANT: This protocol has not been validated on patient samples and should not be used for clinical diagnosis without further validation and certification. ***
Lysis of saliva samples
Mix crude saliva (commercial pooled human saliva from healthy individuals) at 1:1 ratio with QuickExtract DNA Extraction Solution. Incubate at 95 °C for 5 min to ensure complete lysis of virus and inactivation of proteinase K.
(Option A) NASBA Saliva lysatereaction with fluorescence detection
Take 1 μl from the product of Step 1 (saliva lysate) and add into the NASBA reaction mixture (without the enzyme mix) to make a total volume of 15 μl. Reaction mixture can either be prepared in-house or from the Life Sciences NASBA liquid kit (see tables below) using one of the two temperature settings below.
a. Reaction mixture without the enzyme mix is incubated at 65 °C for 2 min followed by a 10-min incubation at 41 °C. Following that, 5 μl enzyme mix is added into the reaction and incubated at 41 °C for a further of 90-120 min.
b. Alternatively, reaction mixture without the enzyme mix is incubated at 95 °C for 5 min followed by a 10-min incubation at 41 °C. Following that, 5 μl enzyme mix is added into the reaction and incubated at 41 °C for a further 90-120 min.
A fluorescence plate reader (e.g. FluoSTAR) can be used to monitor the reaction in real- time, or as an endpoint assay.
| vol. | stock conc. | conc. in RM | ||
| Saliva lysate | 1 μl | |||
| primers*/beacon# mix | 1 μl | 500 nM each primer, 400 nM beacon | 25 nM each primer, 20 nM beacon | |
| spiked-in viral RNA/water | 3 μl | |||
| buffer (NECB-24) | 6.7 μl | |||
| nucleotide (NECN-24) | 3.3 μl | |||
| enzyme mix (NEC-1-24) | 5 μl | |||
| total volume | 20 μl |
Life Sciences reaction mixture (RM)
* Primer sequence available in Materials.
# Molecular beacon is reconstituted with annealing buffer (10 mM Tris pH 8 with 10 μM MgCl2) to the final concentration of 10 μM. Beacon is then annealed by incubation at 85 °C for 5 min, then gradual cooling to 4 °C by 0.1 °C/s before the NASBA reaction.
| vol. | stock conc. | conc. in RM | ||
| Saliva lysate | 1 μl | |||
| primers*/beacon# mix | 1 μl | 25 nM each primer 20 nM beacon | 25 nM each primer 20 nM beacon | |
| spiked-in viral RNA/water | 4 μl | |||
| buffer with DMSO* | 5 μl | |||
| nucleotide mix* | 4 μl | |||
| enzyme mix* | 5 μl | |||
| total volume | 20 μl |
In-house reaction mixture (RM)
* For detailed mixture composition, see tables below. Primer sequence available in Materials.
# Molecular beacon is reconstituted with annealing buffer (10 mM Tris pH 8 with 10 μM MgCl2) to the final concentration of 10 μM. Beacon is then annealed by incubation at 85 °C for 5 min, then gradual cooling to 4 °C by 0.1 °C/s before the NASBA reaction.
| vol. | stock conc. | conc. in RM | ||
| Tris-HCl pH 8.4* | 120 μl | 1 M | 40 mM | |
| MgCl2 | 39.6 μl | 1 M | 13.2 mM | |
| KCl | 112.5 μl | 2 M | 75 mM | |
| DTT | 30 μl | 1 M | 10 mM | |
| DMSO | 450 μl | 100% | 11% | |
| water | 247.9 μl | |||
| total volume | 1000 μl |
Buffer with DMSO
*Tris-HCl pH 8.4 is made in-house by titrating Tris-HCl pH 8.0 with NaOH pellet and pH determined by pH meter.
| vol. | stock conc. | conc. in RM | ||
| Tris-HCl pH 8.4 | 120 μl | 1 M | 40 mM | |
| MgCl2 | 39.6 μl | 1 M | 13.2 mM | |
| KCl | 112.5 μl | 2 M | 75 mM | |
| DTT | 30 μl | 1 M | 10 mM | |
| water | 697.9 μl | |||
| total volume | 1000 μl |
Buffer without DMSO
| vol. | stock conc. | conc. in RM | ||
| dNTP | 0.22 μl each | 100 mM | 1 mM each | |
| NTP | 0.88 μl each | 100 mM | 4 mM each | |
| total volume | 4.4 μl |
Nucleotide mix (incl. 10% excess)
| vol. | stock conc. | conc. in RM | ||
| diluted RNase H | 0.17 μl | 500 U/ml | 3.75 U/ml | |
| Photoscript RT | 0.28 μl | 200000 U/ml | 2500 U/ml | |
| T7 polymerase | 2.75 μl | 50000 U/ml | 6250 U/ml | |
| BSA | 0.13 μl | 20 mg/ml | 0.12 mg/ml | |
| buffer without DMSO | 1.78 μl | |||
| water | 0.40 μl | |||
| total volume | 5.5 μl |
Enzyme mix (incl. 10% excess)
| vol. | stock conc. | ||
| RNase H | 5 μl | 5000 U/ml | |
| BSA (0.48mg/ml) | 1.2 μl | 20 mg/ml | |
| buffer without DMSO | 16.67 μl | ||
| water | 27.13 μl | ||
| total volume | 50 μl |
Diluted RNase H
(Option B) NASBA reaction with lateral flow dipstick detection
For detection with a lateral flow assay, a NASBA lyophilised kit is used with the constitution of the reaction mixture shown below.
Take 4 μl from the product of Step 1 (saliva lysate) and add into the NASBA reaction mixture (without the enzyme mix) to make a total volume of 60 μl. Incubate at 95 °C for 5 min followed by a 10-min incubation at 41 °C.
Following that, 20 μl enzyme mix is added into the reaction and incubated at 41 °C for a further of 90-120 min. Take the reaction product to the sample well of a PCRD test cassette. Results will be shown within 10 min.
Library construction for NGS
To allow for pooled sequencing of NASBA reaction end products, barcode sequences are added upstream of each of the forward and reverse primers (Figure 3a). In addition, an Illumina sequencing adaptor is added upstream of the forward primer barcode sequence as a universal PCR handle (see Materials and reagents section for the exact sequence).
Here, 2 μl NASBA end products from each sample are first pooled into a single tube. Pooled products are then column purified to remove residual NASBA primers (QIAquick PCR Purification Kit). PCR is performed on the column purified pooled sample using two NGS indexing primers. Here, we have designed a customised NGS primer containing the T7 polymerase promoter sequence (see Materials and reagents section for the exact sequence) at the P5 end and used a standard TruSeq sequencing primer at the P7 side. A PCR mix is made based on the table below. A standard PCR program is used with longer elongation time and minimal cycle number to reduce barcode hopping.
| vol. | ||
| 2x PCR mix (KAPA HIFI HotStart ReadyMix) | 20 μl | |
| P5 end primer (10 μM) | 1 μl | |
| P7 end primer (10 μM) | 1 μl | |
| Column purified NASBA product (~3.5 ng dsDNA) | 4 μl | |
| Nuclease free water | 14 μl |
Library construction PCR
| temperature | time | cycle number | |
| 95 °C | 3 min | 1 | |
| 98 °C | 20 s | 15 | |
| 60 °C | 15 s | ||
| 72 °C | 30 s | ||
| 72 °C | 4 min | 1 |
After the PCR, an AMPure bead-based double size selection is carried out (0.55x and 0.75x) to enrich for products of interest. In this study, a MiSeq Reagent Kit v2 (300- cycles) was used for NGS.
Analysis of NGS results
To analyse the INSIGHT NGS data, sequences in FASTQ files are first trimmed to leave the first 80 nucleotides for both read 1 and read 2 using FASTX_trimmer. The trimmed read 1 and paired read 2 are then merged by FLASH. The merged sequence is compared with the reference viral genome sequence (NNNNNACACCTGTGCCTGTTAAACCATTGAAGTTGAAATTGACACATTTGTT TTTAACCAAATTAGTAGACTTTTTAGGTCCACAAACAGTTGCTGGNNNNN, N stands for the barcode position), and only those with a hamming distance less than or equal to 2 are extracted. Here, only substitutions were allowed while insertion- and deletion- containing reads were filtered out. The first 5 nt and the final 5 nt regions of all extracted sequences correspond respectively to the right barcode and the reverse complement of the left barcode. Diagnostic results for sequenced NASBA samples are determined according to the read counts of their corresponding sample-specific barcode pairs. More details can be found in www.github.com/suochenqu/INSIGHT.