Jun 06, 2025

Influenza A, B amplicon-based sequencing protocol using Illumina DNA preplibrary preparation V.1

  • 1National Center for Public Health and Pharmacy, Budapest, Hungary
Icon indicating open access to content
QR code linking to this content
Protocol CitationJudit Henczkó, Dávid uti 2025. Influenza A, B amplicon-based sequencing protocol using Illumina DNA preplibrary preparation. protocols.io https://dx.doi.org/10.17504/protocols.io.81wgbxbx1lpk/v1
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: February 02, 2024
Last Modified: June 06, 2025
Protocol  Integer ID: 94609
Keywords: Illumina DNAprep, Inlfuenza A, Influenza B, WGS, using universal influenza primer, universal influenza primer, timely genomic surveillance of these virus, influenza surveillance, genome sequencing, timely genomic surveillance, monitoring viral evolution, viral isolate, vaccine strain selection, informing vaccine strain selection, genome coverage, viral evolution, genome assembly, high genome coverage, sequencing protocol, detecting antiviral resistance, genome, major contributors to seasonal respiratory infection, whole genome, rna extraction, antiviral resistance, multiplex pcr amplification of all gene segment, virus, reverse transcription, seasonal respiratory infection, rna, gene segment, bioinformatic analysis, whole genome sequencing, sequencing
Abstract
Influenza A and B viruses are major contributors to seasonal respiratory infections and global health burdens. Accurate and timely genomic surveillance of these viruses is critical for monitoring viral evolution, informing vaccine strain selection, and detecting antiviral resistance. This protocol outlines a streamlined workflow for whole-genome sequencing (WGS) of Influenza A and B viruses directly from clinical samples or viral isolates. The process includes RNA extraction, reverse transcription using universal influenza primers, multiplex PCR amplification of all gene segments, library preparation using a tagmentation-based approach, and sequencing on an Illumina platform. Bioinformatic analysis involves quality control, genome assembly, and variant calling using reference-guided alignment. The protocol enables high-throughput, cost-effective sequencing with high genome coverage and accuracy. It is suitable for public health laboratories and research institutions engaged in influenza surveillance and evolutionary studies.
Materials
Reagents:


Illumina DNA/RNA UD Indexes Set B, Tagmentation (96 Indexes, 96 Samples)Illumina, Inc.Catalog #20091656 Illumina DNA/RNA UD Indexes Set B, Tagmentation (96 Indexes, 96 Samples)Illumina, Inc.Catalog #20091656 Illumina DNA/RNA UD Indexes Set C, Tagmentation (96 Indexes, 96 Samples)Illumina, Inc.Catalog #20091658 Illumina DNA Prep, (M) Tagmentation (96 Samples, IPB)Illumina, Inc.Catalog #20060059 Illumina DNA/RNA UD Indexes Set D, Tagmentation (96 Indexes, 96 Samples)Illumina, Inc.Catalog #20091660 Illumina DNA/RNA UD Indexes Set A, Tagmentation (96 Indexes, 96 Samples)Illumina, Inc.Catalog #20091654
Ethanol absolute ≥99.8%VWR International (Avantor)Catalog #20821.365
Qubit™ dsDNA Quantification HS Assay KitsThermo ScientificCatalog #Q32854
Illumina DNA Prep, (M) Tagmentation (96 Samples, IPB)Illumina, Inc.Catalog #20060059
Nuclease-Free WaterThermo Fisher ScientificCatalog #AM9932


  • Pipette Tips, sterile, filtered (assorted volumes)
  • Conical Tubes, 10ml and/or 15ml (FisherSci cat# 14-959-53A or equivalent)
  • Solution basins, sterile (FisherSci cat# 13-681-504 or equivalent)
  • 96-well PCR Plates, semi-skirted, flat deck (FisherSci cat# AB-1400L or equivalent)
  • Microcentrifuge tubes, 1.5 ml, sterile (Thermofisher cat# AM12400 or equivalent)
  • Plate Seals (FisherSci cat# AB-0558 or equivalent )
Qubit Flex Fluorometer (Cat. No. Q33326)
• Qubit Flex Assay Tube Strips, 125 strips (Cat. No. Q33252)
• Qubit Flex System Verification Assay Kit (Cat. No. Q33254)
• Qubit Flex Reservoirs, 100 reservoirs (Cat. No. Q33253)

Consumables:
  1. Qubit Flex 4.0
  2. Thermocycler with heated lid
  3. Microplate centrifuge
  4. Vortex
  5. Magnetic Stand-96 (Thermofisher cat# AM10027) (If possible, have two; one for pre-PCR and one for post-PCR)
  6. Micropipettes (Single and Multichannel)
  7. Ice bucket
  8. Microcentrifuge

Protocol materials
Illumina DNA/RNA UD Indexes Set B, Tagmentation (96 Indexes, 96 Samples)Illumina, Inc.Catalog #20091656
Illumina DNA/RNA UD Indexes Set C, Tagmentation (96 Indexes, 96 Samples)Illumina, Inc.Catalog #20091658
Illumina DNA Prep, (M) Tagmentation (96 Samples, IPB)Illumina, Inc.Catalog #20060059
Ethanol absolute ≥99.8%VWR International (Avantor)Catalog #20821.365
Qubit™ dsDNA Quantification HS Assay KitsThermo ScientificCatalog #Q32854
Illumina DNA/RNA UD Indexes Set D, Tagmentation (96 Indexes, 96 Samples)Illumina, Inc.Catalog #20091660
Illumina DNA/RNA UD Indexes Set A, Tagmentation (96 Indexes, 96 Samples)Illumina, Inc.Catalog #20091654
Nuclease-Free WaterThermo Fisher ScientificCatalog #AM9932
TURBO DNase 2 U/uLFisher ScientificCatalog #AM2239
Ethanol absolute, KOPTEC, meets analytical specification of BP, Ph. Eur., USP (200 Proof)Avantor SciencesCatalog #89125-176
AMPure XP Beads (AXP)Beckman CoulterCatalog #AXP
Illumina® DNA/RNA UD Indexes Set A, B, C, D Tagmentation (96 Indexes, 96 Samples)Illumina, Inc.Catalog #20091654, 20091656, 20091658, 20
Safety warnings
Always use IC during the PCR and alwaxs check the RNA integrity!
RNA extraction
RNA extraction
Samples were extracted using QIAamp Viral RNA Mini kit (Catalog # 52904). Real time RT-PCR (CDC 2009) was performed on all samples to determine viral load with Cycle threshold (Ct) value. Samples with a Ct value <32 are recommended for optimal results.
RNA integrity affect the quality and the yield of Library!

DNAse treatment
DNAse digestion by using Turbo DNAse
TURBO DNase 2 U/uLFisher ScientificCatalog #AM2239
Create a master mix of Turbe DNAse:

Add 1 μL TURBO DNase (2 U) (for up to 10 μg RNA in a 50 μL reaction), 5µL TURBO DNase Buffer, and 14µL of H2O per sample.
30:00 min 37 °C

cDNA synthesis and amplification
Reagents:
Invitrogen SuperScript III One-Step RT-PCR System with PlatinumTaqHigh Fidelity DNA Polymerase (cat. no. 12574035)

Oligos for amplicon generation (7,8):

AB
PrimerSequence
Uni12/Inf-1GGGGGGAGCAAAAGCAGG
Uni12/Inf-3GGGGGGAGCGAAAGCAGG
Uni13/Inf-1CGGGTTATTAGTAGAAACAAGG
B-PBs-UniFGGGGGGAGCAGAAGCGGAGC
B-PBs-UniRCCGGGTTATTAGTAGAAACACGAGC
B-PA-UniFGGGGGGAGCAGAAGCGGTGC
B-PA-UniRCCGGGTTATTAGTAGAAACACGTGC
B-HANA-UniFGGGGGGAGCAGAAGCAGAGC
B-HANA-UniRCCGGGTTATTAGTAGTAACAAGAGC
B-NP-UniFGGGGGGAGCAGAAGCACAGC
B-NP-UniRCCGGGTTATTAGTAGAAACAACAGC
B-M-Uni3FGGGGGGAGCAGAAGCACGCACTT
B-Mg-Uni3FGGGGGGAGCAGAAGCAGGCACTT
B-M-Uni3RCCGGGTTATTAGTAGAAACAACGCACTT
B-NS-Uni3FGGGGGGAGCAGAAGCAGAGGATT
B-NS-Uni3RCCGGGTTATTAGTAGTAACAAGAGGATT
PCR mix:
AB
ComponentsVolume (µl) for 1 x rxn
SuperScript III RT/ Platinum Taq High Fidelity Enzyme Mix0.5
2X Reaction Mix (a buffer containing 0.4 mM of each dNTP12,5
RNAse/DNAse free water5.5
primer pool (10 μM)2,5
Total volume20
Template RNA (1 pg to 1 μg)*5
Final volume*25.0
* scale up if needed

PCR conditions:
ABCD
StepTemperatureDurationNumber of cycle
Reverse transcription42°C60 mins1x
Activation/initial denaturation94°C2 mins1x
Amplification94°C15 sec7x
44°C30 sec
68°C5 min
94 °C20 sec35x
58 °C1 min
68 °C5 min
Final extension68 °C10 min1x
HOLD12°Cinfiniteinfinite
Note:
  • Keep all components, reaction mixes, and samples on ice. After preparation of the samples, transfer them to the preheated thermal cycler and immediately start the RT–PCR program.
  • If the ct vaue is higher than the expected <32, scale up reactions

cDNA synthesis and amplification
Clean up with Ampure bead


AMPure XP Beads (AXP)Beckman CoulterCatalog #AXP
Ethanol absolute, KOPTEC, meets analytical specification of BP, Ph. Eur., USP (200 Proof)Avantor SciencesCatalog #89125-176
Nuclease-Free WaterThermo Fisher ScientificCatalog #AM9932

1. Take the beads to room temperature before use!
2. Shake the AMPure XP bottle to resuspend any magnetic particles that may have settled. Then add 1,8x AMPure XP reagent.
3. Mix reagent and sample thoroughly by pipette mixing 10 times. Let the mixed samples incubate for 5 minutes at room temperature for maximum recovery.
4. Place the reaction plate onto the SPRIPlate 96R Ring Super Magnet Plate for 2 minutes to separate beads from the solution. Wait for the solution to clear before proceeding to the next step.

5. Perform this step with the reaction plate situated on the SPRIPlate 96R Ring Super Magnet Plate. Do not disturb the separated magnetic beads. Also, be sure to remove all of the ethanol from the bottom of the well. Dispense 200 μL of 80% ethanol to each well of the reaction plate and incubate for 30 seconds at room temperature. Aspirate out the ethanol and discard.
6. Repeat for a total of two washes.
7. Dry the beads and do not over dry the bead ring (bead ring appears cracked if over dried) as this will significantly decrease elution efficiency.
8. Remove the reaction plate from the magnet plate, and then add 52 μL of elution buffer (RNAse/DNAse-free water) to each well of the reaction plate and pipette mix 10 times. Incubate for 2 minutes.
9.Place the reaction plate onto the SPRIPlate 96R Ring Super Magnet Plate for 1 minute to separate beads from the solution.
10. Transfer 50 ul of the eluate to a new plate.








QC using Qubit
Quantify samples using the Qubit dsDNA High Sensitivity kit. See SOP titled“DNA Quantification using the Qubit Fluorometer” for more detailed information on performing DNA quantification.
Library preparation with Illumina DNAprep
Tagmenation
Consumables:
BLT (Bead-Linked Transposomes)
TB1 (Tagmentation Buffer 1)
               •             Nuclease-free water
               •             8-tube strip
               •             96-well PCR plate
               •             Microseal 'B' adhesive seal
               •            20 µl Pipette tips
•            200 µl Pipette tips
 Mix :          
BLT (11 μl)
TB1 (11 μl) 1.Use a new plate and add 20 ul mix to 30 ul previously eluated sample.
2. Gently pipette up and down 10 times
3. Seal the plate
4. Centrifuge down the samples (gently)
5. Incubate the samples as a follows:
37 °C 15:00 min 10 °C

Clean up with TWB
  1. Remove the plate seal.
  2. Add 10ul of TSB to each sample ( Use a multi-channel pipette) and gently pipette up and down 10 times to mix and fully resuspend the beads in the 50 μl reaction.
  3. Apply an adhesive PCR plate seal to the plate.
  4. Place the plate into the thermocyler and incubate at for37 °C followed by a 10 °C hold
  5. While samples are incubating, thaw EPM on ice.
  6. Remove the plate from the thermocycler, quick spin the plate and remove the seal.
  7. Place the plate on a magnet and incubate it until solution is clear.
  8. Using a multichannel pipette, remove the supernatant and discard.
  9. Remove the plate from the magnet and add of TWB directly to the pellet.
  10. Gently pipette to mix until beads are fully resuspended, try to avoid creation of foam from TWB.
  11. Place the plate on the magnet for or until solution is clear.
  12. Remove the supernatant and discard.
  13. Remove the plate from the magnet and add of TWB directly to the pellet.
  14. Gently pipette to mix until beads are fully resuspended.
  15. Place the plate on the magnet for 00:03:00 or until solution is clear.
  16. Remove the supernatant and discard.
  17. Remove the plate from the magnet and add 100 µL of TWB directly to the pellet. Gently pipette to mix until beads are fully resuspended.
  18. Place the plate with TWB on the magnet and avoid overdrying and incubate until ready to proceed with adding the PCR master mix in the Amplify Tagmented DNA step.
Amplification and indexing

Vortex the EPM to mix, then briefly centrifuge.
Add:
22 ul EPM and
22 ul Water

19. Remove and discard TWB. Avoid overdrying! 20. Add 40 ul EPM mix to the beads.
21. Add 10 ul Illumina UD index to the mixIllumina® DNA/RNA UD Indexes Set A, B, C, D Tagmentation (96 Indexes, 96 Samples)Illumina, Inc.Catalog #20091654, 20091656, 20091658, 20

Incubate as a follows:

PCR conditions:
ABCD
StepTemperatureDurationNumber of cycle
Activation/initial denaturation68°C3 mins1x
98°C3 mins
Amplification
98°C45 sec12x
62°C30 sec
68 °C2 min
Final extension68 °C2 min1x
HOLD12°Cinfiniteinfinite



Clean up libraries

Centrifuge at 280 × g for 1 minute to collect contents at the bottom of the well.
            2.         Place the plate on the magnetic stand and wait until the liquid is clear (~5 minutes).
            3.         Transfer 45 µl supernatant from each well of the a PCR plate.
            4.         Resuspend IPB
            5.    Add 40 µl nuclease-free water to each well-containing supernatant.
            6.         Add 45 µl IPB to each well-containing supernatant.
            7.         Pipette each well 10 times to mix.
            8.         Seal the plate and incubate at room temperature for 5 minutes.
            9.         Place on the magnetic stand and wait until the liquid is clear (~5 minutes).
            10.        Add 15 µl to each well of a new MIDI plate.
            11.         Transfer 125 µl supernatant from each well the new MIDI plate containing 15 µl IPB.
            12.         Incubate the sealed MIDI plate at room temperature for 5 minutes.
            13.         Place on the magnetic stand and waituntil the liquid is clear (~5 minutes).
            14.         Without disturbing the beads, remove and discard supernatant.
            15.       Wash beads as follows.
            16.         With the plate on the magnetic stand, add 200 µl fresh 80% EtOH without mixing.
            17.         Incubate for 30 seconds.
            18.         Without disturbing the beads, remove and discard supernatant.
            19.       Wash beads a second time.
            20.       Use a 20 µl pipette to remove and discard residual EtOH.
            21.       Air-dry on the magnetic stand for 5 minutes.
            22.       Remove from the magnetic stand.
            23.       Add 32 µl RSB to the beads.
            24.       Pipette to resuspend.
            25.       Incubate at room temperature for 2 minutes.
            26.       Place the plate on the magnetic stand and wait until the liquid is clear (~2 minutes).
27. Transfer 30 µl supernatant to a new 96-well PCR plate.
SAFE STOPPING POINT If you are stopping, seal the plate with Microseal 'B' adhesive seal or Microseal 'F' foil seal, and store at ‑25°C to ‑15°C for up to 30 days.


SAFE STOPPING POINT

If you are stopping,
seal the plate with Microseal 'B' adhesive seal or Microseal 'F' foil
seal, and store at ‑25°C to ‑15°C for up to 30 days.

Pool Libraries
Combine 5-10 ul of libraries.
Dilute pooled libraries according to the Illumina Denature and dilute protocols.
Protocol references
5. Lee, H.K., Lee, C.K., Tang, J.W.T., Loh, T.P. and Koay, E.S.C., 2016. Contamination-controlled high-throughput whole genome sequencing for influenza A viruses using the MiSeq sequencer. Scientific reports, 6(1), pp.1-11.
6. Imai, K., Tamura, K., Tanigaki, T., Takizawa, M., Nakayama, E., Taniguchi, T., Okamoto, M., Nishiyama, Y., Tarumoto, N., Mitsutake, K. and Murakami, T., 2018. Whole genome sequencing of influenza A and B viruses with the MinION sequencer in the clinical setting: a pilot study. Frontiers in Microbiology, 9, p.2748.
7. Zhou, B. and Wentworth, D.E., 2012. Influenza A virus molecular virology techniques. Influenza virus: methods and protocols, pp.175-192.
8. Zhou, B., Lin, X., Wang, W., Halpin, R.A., Bera, J., Stockwell, T.B., Barr, I.G. and Wentworth, D.E., 2014. Universal influenza B virus genomic amplification facilitates sequencing, diagnostics, and reverse genetics. Journal of clinical microbiology, 52(5), pp.1330-1337.
10. Bruinsma, S., Burgess, J., Schlingman, D., Czyz, A., Morrell, N., Ballenger, C., Meinholz, H., Brady, L., Khanna, A., Freeberg, L. and Jackson, R.G., 2018. Bead-linked transposomes enable a normalization-free workflow for NGS library preparation. BMC genomics, 19(1), pp.1-16.
  1. Zhou, B., et al. (2009). Single-reaction genomic amplification accelerates sequencing and vaccine production for classical and Swine origin human influenza A viruses. Journal of Virology, 83(19), 10309–10313. https://doi.org/10.1128/JVI.01109-09
  2. Ghedin, E., et al. (2005). Large-scale sequencing of human influenza reveals the dynamic nature of viral genome evolution. Nature, 437(7062), 1162–1166. https://doi.org/10.1038/nature04239
  3. Watson, S. J., et al. (2015). Viral population analysis and minority-variant detection using short read next-generation sequencing. Philosophical Transactions of the Royal Society B: Biological Sciences, 370(1678), 20140203. https://doi.org/10.1098/rstb.2014.0203
  4. World Health Organization (2023). WHO Manual for the Laboratory Diagnosis and Virological Surveillance of Influenza. https://www.who.int/publications/i/item/manual-for-the-laboratory-diagnosis-and-virological-surveillance-of-influenza