Apr 28, 2026
Influenza A and B virus WGS using Illumina Microbial Amplicon Prep (iMAP) half reaction
- Kerwin Liedeman1,
- Stepfan de Villiers1,
- Lucious Chabuka1,
- Velda Wentzel1,
- Tebogo Ramakutoane1,
- Nondumiso Zakwe1,
- Ottovon Dakurah1,
- Eduan Wilkinson1,
- Marije Hofstra1,
- Cheryl Baxter1,2,
- Lavanya Singh1,
- Tulio De Oliveira1,3
- 1Centre for Epidemic Response and Innovation, School for Data Science and Computational Thinking, Stellenbosch University;
- 2Division of Medical Virology, Faculty of Medicine and Health Science, Stellenbosch University;
- 3KwaZulu-Natal Research Innovation and Sequencing Platform (KRISP), University of KwaZulu-Natal
Protocol Citation: Kerwin Liedeman, Stepfan de Villiers, Lucious Chabuka, Velda Wentzel, Tebogo Ramakutoane, Nondumiso Zakwe, Ottovon Dakurah, Eduan Wilkinson, Marije Hofstra, Cheryl Baxter, Lavanya Singh, Tulio De Oliveira 2026. Influenza A and B virus WGS using Illumina Microbial Amplicon Prep (iMAP) half reaction . protocols.io https://dx.doi.org/10.17504/protocols.io.x54v9q49ql3e/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: April 15, 2026
Last Modified: April 28, 2026
Protocol Integer ID: 315070
Keywords: effective genome amplification of influenza virus, influenza virus, using illumina microbial amplicon prep, illumina microbial amplicon prep, whole genome sequencing, genome sequencing, effective genome amplification, imap, virus, individual library clean
Funders Acknowledgements:
Global Health EDCTP3 Joint Undertaking
Grant ID: 101103171
Bill & Melinda Gates Foundation
Grant ID: 101103171
South African Medical Research Council
Grant ID: 96707/23139
Abstract
This protocol describes whole-genome sequencing (WGS) of Influenza A and B viruses using the Illumina Microbial Amplicon Prep (iMAP). The protocol has been adapted by miniaturising reagent use to half-reactions and by incorporating primers originally developed by Zhou and Wentworth (2012) and (2014) for effective genome amplification of Influenza viruses. In addition, the standard pooled library clean-up procedure was modified to perform individual library clean-ups, which improved overall library quality and consistency before sequencing.
Materials
Eppendorf, Twin.Tec, LoBind, 96-Well PCR PlatesEppendorfCatalog #EP0030129504
Eppendorf 1.5ml, lo-bind, tubesEppendorfCatalog #EP0030108418
Illumina Microbial Amplicon PrepIlluminaCatalog #20097857
Library Quantification Kit (500 rxns)Takara BioCatalog #638324
Agilent D1000 Reagents AgilentCatalog #(P/N 5067-5583)
Agilent D1000 ScreenTape AgilentCatalog #(P/N 5067-5582)
Qubit™ 1X dsDNA High Sensitivity (HS)Invitrogen - Thermo FisherCatalog #Q33231
IDTE (1X TE Solution) 1LIntegrated DNA Technologies, Inc. (IDT)Catalog #11-05-01-09
Ethanol, Absolute, Molecular Grade, 500MLMerckCatalog #E7023-500ML
Adhesive Clear PCR Plate SealsThermo Fisher ScientificCatalog #AB0558
Adhesive Optical PCR Plate SealsThermo Fisher ScientificCatalog #4311971
TrueMark™ SARS-CoV-2, Flu A, Flu B, RSV Select PanelApplied Biosystems (ThermoFisher Scientific)Catalog #A59526
VWR 10ul, LR, Extended Filter TipsVWRCatalog #VWRA612-6260
VWR 200ul, LR, Filter TipsVWRCatalog #VWRA612-6179
VWR 1000ul Filter Tips, LR, Filter TipsVWRCatalog #VWRA612-6272
8-Strip Tubes with caps, 0,2mlApplied Biosystems (ThermoFisher Scientific)Catalog #AB2000
chemagic™ Viral DNA/RNA 300 Kit H96RevvityCatalog #CMG-1033-S
QIAamp Viral RNA Mini KitQiagenCatalog # 52904/52906
Protocol materials
Resuspension BufferIllumina
Illumina Purification BeadsIllumina
Qubit™ dsDNA HS Assay KitInvitrogen - Thermo Fisher
Library Quantification Kit Takara BioCatalog #Cat. No. 638319
D1000 Screen TapeAgilent Technologies
Eppendorf 1.5ml, lo-bind, tubesEppendorfCatalog #EP0030108418
VWR 10ul, LR, Extended Filter TipsVWRCatalog #VWRA612-6260
chemagic™ Viral DNA/RNA 300 Kit H96RevvityCatalog #CMG-1033-S
Library Quantification Kit (500 rxns)Takara BioCatalog #638324
IDTE (1X TE Solution) 1LIntegrated DNA Technologies, Inc. (IDT)Catalog #11-05-01-09
Ethanol, Absolute, Molecular Grade, 500MLMerckCatalog #E7023-500ML
Adhesive Clear PCR Plate SealsThermo Fisher ScientificCatalog #AB0558
Adhesive Optical PCR Plate SealsThermo Fisher ScientificCatalog #4311971
VWR 200ul, LR, Filter TipsVWRCatalog #VWRA612-6179
VWR 1000ul Filter Tips, LR, Filter TipsVWRCatalog #VWRA612-6272
Illumina Microbial Amplicon PrepIlluminaCatalog #20097857
Qubit™ 1X dsDNA High Sensitivity (HS)Invitrogen - Thermo FisherCatalog #Q33231
Eppendorf, Twin.Tec, LoBind, 96-Well PCR PlatesEppendorfCatalog #EP0030129504
TrueMark™ SARS-CoV-2, Flu A, Flu B, RSV Select PanelApplied Biosystems (ThermoFisher Scientific)Catalog #A59526
Agilent D1000 Reagents AgilentCatalog #(P/N 5067-5583)
Agilent D1000 ScreenTape AgilentCatalog #(P/N 5067-5582)
8-Strip Tubes with caps, 0,2mlApplied Biosystems (ThermoFisher Scientific)Catalog #AB2000
QIAamp Viral RNA Mini KitQiagenCatalog # 52904/52906
Before start
This protocol starts with extracted RNA or TNA.
We use pre-sequencing sample qualification by RT-qPCR:
- RNA/TNA extracts are screened using the TrueMark SARS-CoV-2 Flu A Flu B RSV Select Panel.
- Samples with Ct values above 30 are excluded from sequencing.
As quality controls, we include a positive control, consisting of a commercially prepared strain or a previously sequenced sample, and a negative control (nuclease-free water) in every run.
Preparation of primer pool
Prepare the Influenza AB primer pool as described here
Individual primers were obtained as desalted, dried stock from Integrated DNA Technologies (IDT).
Each primer must be resuspended in 0.1× TE buffer to a final concentration of 100 micromolar (µM) , as per the individual specification sheets supplied.
Add the volumes specified in the table below for each primer to the primer pool.
It is recommended to make more than one pool to prevent multiple freeze-thaw cycles.
| Primer Name | Primer sequence 5' to 3' | Stock Conc. (µM) | Volume (µL) into pool | |
| Uni12/Inf-1 | GGGGGGAGCAAAAGCAGG | 100 | 16.8 | |
| Uni12/Inf-3 | GGGGGGAGCGAAAGCAGG | 100 | 25.2 | |
| Uni13/Inf-1 | CGGGTTATTAGTAGAAACAAGG | 100 | 42 | |
| B-PBs-UniF | GGGGGGAGCAGAAGCGGAGC | 100 | 12 | |
| B-PBs-UniR | CCGGGTTATTAGTAGAAACACGAGC | 100 | 12 | |
| B-PA-UniF | GGGGGGAGCAGAAGCGGTGC | 100 | 5 | |
| B-PA-UniR | CCGGGTTATTAGTAGAAACACGTGC | 100 | 5 | |
| B-HANA-UniF | GGGGGGAGCAGAAGCAGAGC | 100 | 10 | |
| B-HANA-UniR | CCGGGTTATTAGTAGTAACAAGAGC | 100 | 10 | |
| B-NP-UniF | GGGGGGAGCAGAAGCACAGC | 100 | 8 | |
| B-NP-UniR | CCGGGTTATTAGTAGAAACAACAGC | 100 | 8 | |
| B-M-Uni3F | GGGGGGAGCAGAAGCACGCACTT | 100 | 4 | |
| B-Mg-Uni3F | GGGGGGAGCAGAAGCAGGCACTT | 100 | 4 | |
| B-M-Uni3R | CCGGGTTATTAGTAGAAACAACGCACTT | 100 | 8 | |
| B-NS-Uni3F | GGGGGGAGCAGAAGCAGAGGATT | 100 | 6 | |
| B-NS-Uni3R | CCGGGTTATTAGTAGTAACAAGAGGATT | 100 | 6 |
Influenza A virus and Influenza B virus primers
Alternatively, the Illumina Microbial Amplicon Prep - Influenza A/B Kit (Catalogue #20106305) can be purchased, which includes the influenza A/B targeting primer pool.
Each pool is then diluted to 10 micromolar (µM) working stocks using nuclease-free water.
The 10 micromolar (µM) stock dilutions are to be used for the One-Step RT-PCR.
One-Step RT-PCR and PCR clean up
1h 6m
Prepare the one-step RT-PCR Master mix and perform PCR following the steps below.
| Reagent | Storage | Instructions | |
| FSM (First Strand Mix) | -25°C to -15°C | Thaw at room temperature. Vortex to mix and keep on ice. | |
| RVT (Reverse Transcriptase) | -25°C to -15°C | Thaw on ice. Vortex to mix and keep on ice. | |
| Flu AB Primer Pool | -25°C to -15°C | Thaw on ice. Vortex to mix and keep on ice. | |
| IPM (Illumina PCR Mix) | -25°C to -15°C | Thaw on ice. Vortex to mix and keep on ice. |
Overview of reagents
In a microcentrifuge tube, combine the following reagents to prepare the One-Step RT-PCR Master Mix.
The table indicates the required volume for 1 sample. Calculate the volumes required for the amount of samples included in the run.
| Reagent | Volume (μL) per sample | Required volume for x samples | |
| FSM | 1.6 | ... | |
| RVT | 0.5 | ... | |
| IPM | 7.5 | ... | |
| Primer Pool (10 µM) | 0.6 | ... | |
| Nuclease-free water | 1.8 | ... | |
| Total | 12.0 | ... |
RT-PCR Master Mix
5m
Add 12 µL master mix to each well of a new 96 wells plate labelled PCR plate.
Add 3 µL RNA to each well.
5m
Seal, vortex (1600 rpm 00:01:00 ), centrifuge (500 x g for 00:01:00 ).
2m
Place on a thermal cycler and run the Flu RT-PCR program as described below.
Preheat Lid: 105 °C and Reaction Volume: 15 µL
| Temperature (°C) | Time | Cycle | |
| 42 | 60 minutes | ||
| 94 | 2 minutes | ||
| 94 | 20 seconds | 5 cycles | |
| 44 | 30 seconds | ||
| 68 | 3 minutes | ||
| 94 | 20 seconds | 35 cycles | |
| 58 | 30 seconds | ||
| 68 | 3 minutes | ||
| 68 | 5 minutes | ||
| 4 | Hold |
Flu RT-PCR program
Note
Safe Stopping Point – seal the plate and store at 2°C to 8°C or leave on the thermal cycler overnight.
PCR Clean Up Step
Centrifuge the PCR plate at 500 x g for 00:01:00 .
2m
Vortex to resuspend the IPB and add 9 µL to each well of the PCR plate.
5m
Vortex to mix and centrifuge briefly.
2m
Incubate at Room temperature for 00:05:00
5m
Place it on a magnetic stand and wait for the liquid to clear (~00:05:00 ).
Remove and discard the supernatant.
5m
Wash beads as follows:
a. Keep the plate on the magnetic stand and add 100 µL 80% EtOH to each well.
b. Wait00:00:30 , then remove and discard the supernatant.
3m
Wash the beads a second time.
3m
Centrifuge the plate briefly to collect any remaining EtOH at the bottom.
Place it on the magnetic stand and wait for the liquid to clear.
Use a P20 pipette to remove ALL residual EtOH.
3m
Allow to air-dry on the magnetic stand for 00:01:00
1m
Add16 µL RSB to resuspend the beads. Vortex to mix and then centrifuge briefly.
5m
Incubate at Room temperature for 00:02:00 .
2m
Place the plate on the magnetic rack and wait for the liquid to clear (~ 00:03:00 ).
3m
Transfer 15 µL of supernatant to the wells of a new PCR plate labelled cDNA.
5m
At least 10% of the samples should be checked post-PCR using a Qubit Fluorometer and Qubit DNA HS Assay to ensure amplification was successful.
10m
Tagment PCR Amplicons
42m
Prepare Tagmentation Master Mix, add cDNA and run Tagmentation as described in the steps below.
| Reagent | Storage | Instructions | |
| EBLT (Enrichment BLT) | 2°C to 8°C | Bring to room temperature. Vortex thoroughly before use. | |
| TB1 (Tagmentation Buffer 1) | -25°C to -15°C | Bring to room temperature. Vortex thoroughly before use. |
Overview of reagents
In a microcentrifuge tube, combine the following reagents to prepare the Tagmentation Master Mix.
The table indicates the required volume for 1 sample. Calculate the volumes required for the amount of samples included in the run. *volumes include overage.
| Reagent | Volume (μL) per sample | Required volume for x samples | |
| EBLT | 2 | ... | |
| TB1 | 6 | ... | |
| Nuclease-free water | 10 | ... | |
| Total | 18 | ... |
Tagmentation Master Mix
5m
Add15 µL of the master mix to each well of a new PCR plate labelled TAG.
Add 10 µL from the cDNA plate to the corresponding wells of the TAG plate.
5m
Seal, vortex 1600 rpm, 00:01:00 , centrifuge 500 x g, 00:01:00 .
2m
Place on a thermal cycler and run the TAG program.
Preheat Lid: 105 °C and Reaction Volume: 25 µL
| Temperature (°C) | Time | |
| 55 | 5 minutes | |
| 10 | Hold |
TAG Program
Post tagmentation Clean Up step
| Reagent | Storage | Instructions | |
| ST2 (Stop Tagment Buffer 2) | Room Temp | Vortex before use. | |
| TWB (Tagmentation Wash Buffer) | 2°C to 8°C | Invert to mix. |
Overview of reagents
After the TAG program, immediately add 5 µL ST2 to each well of the TAG plate.
5m
Seal, vortex 1600 rpm, 00:01:00 , centrifuge 500 x g, 00:01:00 .
2m
Incubate 00:05:00 at Room temperature .
5m
Centrifuge briefly.
1m
Place it on a magnetic stand and wait until the liquid is clear (approximately 00:03:00 )
Remove and discard the supernatant.
3m
Wash beads as follows:
a. Remove the plate from the magnetic stand.
b. Add 50 µL TWB to each well.
c. Seal, vortex 1600 rpm, 00:01:00 , centrifuge (500 x g, 00:01:00 .
d. Place it on the magnetic stand and wait until the liquid is clear (~ 00:02:00 ).
e. Remove and discard the supernatant.
8m
Wash the beads a second time.
Leave supernatant in the plate after the second wash to prevent beads from overdrying.
6m
Amplify Tagmented Amplicons
16m
Prepare the TAG PCR Master Mix and perform TAG PCR following the steps below.
| Reagent | Storage | Instructions | |
| EPM (Enriched PCR Mix) | -25°C to -15°C | Invert to mix. Keep on ice until use. | |
| Index Adapters | -25°C to -15°C | Thaw at room temperature. Vortex to mix and then centrifuge. Keep on ice. |
Overview of reagents
In a microcentrifuge tube, combine the following reagents to prepare the TAG PCR Master Mix.
*volumes include overage.
| Reagent | Volume (μL) per sample | Required volume for x samples | |
| EPM | 12 | ... | |
| Nuclease-free water | 12 | ... | |
| Total | 24 | ... |
TAG PCR Master Mix
5m
Vortex the TAG PCR master mix thoroughly.
1m
Keep the TAG plate on the magnetic stand and remove the TWB.
Use a P20 pipette to remove any remaining TWB from each well.
2m
Remove the TAG plate from the magnetic stand.
1m
Add 20 µL TAG PCR master mix to each well.
Add 5 µL Index Adapters to each well.
5m
Seal the plate, vortex at 1600 rpm, 00:01:00 , and centrifuge at 500 x g, 00:01:00 .
2m
Place the plate on a thermal cycler and run the TAG PCR program.
Preheat Lid: 100 °C and Reaction Volume: 25 µL
| Temperature (°C) | Time | Cycle | |
| 72 | 3 minutes | ||
| 98 | 3 minutes | ||
| 98 | 20 seconds | 7 cycles* | |
| 60 | 30 seconds | ||
| 72 | 1 minutes | ||
| 72 | 3 minutes | ||
| 10 | Hold |
TAG PCR Program
*To compensate for lower cDNA input amounts, the number of PCR cycles can be increased as follows:
| Total cDNA Input (ng) | Number of PCR cycles | |
| 1-24 | 12 | |
| 25-99 | 9 | |
| 100-500 | 7 |
Note
Safe Stopping Point - seal the plate and store at -25°C to -15°C
Clean-Up Libraries
53m
| Reagent | Storage | Instructions | |
| IPB (Illumina Purification Beads) | Room Temperature | Vortex thoroughly to mix. | |
| RSB (Resuspension Buffer) | 2°C to 8°C | Bring to room temperature. Invert to mix. | |
| Ethanol | Room Temperature | Prepare a fresh solution of 80% EtOH |
Overview of reagents
Centrifuge the TAG plate at 500 x g for 00:01:00 .
1m
Place it on a magnetic stand and wait until the liquid is clear (~00:03:00 ).
3m
Label a new PCR plate IPB.
1m
Vortex the IPB tube to resuspend and add 22.5 µL IPB to each well of the IPB plate.
5m
Transfer 25 µL supernatant from each well of the TAG plate to the corresponding wells of the IPB plate.
5m
Vortex to mix and centrifuge briefly.
2m
Incubate at Room temperature for 00:05:00 .
5m
Place it on a magnetic stand and wait for the liquid to clear (~00:05:00 ).
Without disturbing the beads, remove and discard the supernatant.
5m
Wash the beads as follows:
a. With the plate on the magnetic stand, add 100 µL of 80% EtOH to each well.
b. Incubate for 00:00:30 , then remove and discard the supernatant.
3m
Wash the beads a second time.
3m
After the second wash, briefly centrifuge the plate to collect any remaining EtOH at the bottom of the wells. Place it back on the magnetic stand and wait for the liquid to clear.
Using a P20 pipette, remove and discard ALL residual EtOH from the wells.
2m
Allow the plate to air-dry on the magnetic stand for 00:01:00 .
1m
Add 16 µL RSB to each well to resuspend the beads.
5m
Vortex to mix and centrifuge briefly.
2m
Incubate atRoom temperature for 00:02:00 .
2m
Place the plate on the magnetic rack and wait for the liquid to clear (~ 00:03:00 ).
3m
Transfer 15 µL of the supernatant to a new final PCR plate.
Note
Safe Stopping Point - seal the plate and store at -25°C to -15°C
5m
Quantify and Normalize Libraries
48m
Quantify and normalise libraries following the steps below:
Analyse 1 µL of each prepared library using the Qubit dsDNA HS Assay on a Qubit fluorometer.
10m
Calculate the molarity of each prepared library (use 350 bp as the average library size).
Dilute each library to a normalized concentration of 4 nanomolar (nM) using RSB.
15m
Pool 5 µL from each library into a clean 1.5 mL microcentrifuge tube.
3m
Quantify the pool by qPCR using the Takara Library Quantification Kit.
[Optional] Run 1 µL of the library pool on a TapeStation using the D1000 ScreenTape assay to confirm the average library size.
Using the qPCR quantification, dilute the library to the starting concentration for your chosen sequencing platform/kit.
5m
Follow the denature and dilute instructions for your chosen sequencing platform by referring to the manufacturer's user guides.
15m
| Sequencing Platform/Kit | Starting Concentration (nM) | Final Loading Concentration (pM) | |
| NextSeq (Standard-SBS) | 2 | 750 | |
| NextSeq (XLEAP-SBS) | 2 | 650 | |
| MiSeq i100 | 2 | 80 | |
| MiSeq V2 | 4 | 10-12 | |
| MiSeq V3 | 4 | 12-14 |
Loading Concentration Recommendations by Platform/ Kit
Protocol references
1. Zhou B, Wentworth DE. Influenza A virus molecular virology techniques. Methods Mol Biol. 2012; 865:175-92. doi: 10.1007/978-1-61779-621-0_11. PMID: 22528160.
2. Zhou B, Lin X, Wang W, Halpin RA, Bera J, Stockwell TB, Barr IG, Wentworth DE. Universal influenza B virus genomic amplification facilitates sequencing, diagnostics, and reverse genetics. J Clin Microbiol. 2014 May;52(5):1330-7. doi: 10.1128/JCM.03265-13. Epub 2014 Feb 5. PMID: 24501036; PMCID: PMC3993638.
3. Illumina. Illumina Microbial Amplicon Prep—Influenza A/B Reference Guide. Document #200044077 v01. Illumina, Inc.
Acknowledgements
The GenPath Africa project is funded by the Global Health EDCTP3 Joint Undertaking and its members, as well as the Bill & Melinda Gates Foundation (101103171) and the South African Medical Research Council.