Dec 12, 2024
In vitro Transcription (IVT) of Guide RNAs for Cytoplasmic Microinjection
- Jayshen Arudkumar1,2,
- Yu Chinn Joshua Chey1,2,
- Sandra Piltz1,2,
- Paul Quinton Thomas1,2,
- Fatwa Adikusuma1,2
- 1University of Adelaide;
- 2SAHMRI
External link: https://doi.org/10.1186/s44330-024-00019-y
Protocol Citation: Jayshen Arudkumar, Yu Chinn Joshua Chey, Sandra Piltz, Paul Quinton Thomas, Fatwa Adikusuma 2024. In vitro Transcription (IVT) of Guide RNAs for Cytoplasmic Microinjection. protocols.io https://dx.doi.org/10.17504/protocols.io.36wgq3kdylk5/v1
Manuscript citation:
Arudkumar, J., Chey, Y.C.J., Piltz, S.G. et al. CRISPR-mediated generation and comprehensive phenotyping of Duchenne Muscular Dystrophy mouse models. BMC Methods 1, 19 (2024). https://doi.org/10.1186/s44330-024-00019-y
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: January 15, 2024
Last Modified: December 12, 2024
Protocol Integer ID: 93518
Keywords: CRISPR, Microinjection, mouse, embryo, DMD, Phenotyping, Knockout, protocol for crispr injection, crispr microinjection of embryo, crispr injection, crispr microinjection, murine models of duchenne muscular dystrophy, duchenne muscular dystrophy, crispr, guide rnas for cytoplasmic microinjection paper, cas9 gene, molecular testing at the dna, broader landscape of genetic disorder investigation, guide rna, using mouse model, molecular testing, mouse model, gene, mouse dmd target region, genetic disorder investigation, generation of diverse animal model, mouse dmd target region of exon, mouse zygote, rna, embryo, murine model, serum creatine kinase, permanent modifications to dna, diverse animal model
Disclaimer
These protocols are for research purposes only.
Abstract
Paper abstract: CRISPR-Cas9 gene-editing technology has revolutionised the creation of precise and permanent modifications to DNA, enabling the generation of diverse animal models for investigating potential treatments. Here, we provide a protocol for the use of CRISPR-Cas9 to create murine models of Duchenne Muscular Dystrophy (DMD) along with a step-by-step guide for their phenotypic and molecular characterisation. The experimental procedures include CRISPR microinjection of embryos, molecular testing at the DNA, RNA, and protein levels, forelimb grip strength testing, immunostaining and serum creatine kinase (CK) testing. We further provide suggestions for analysis and interpretation of the generated data, as well as the limitations of our approach. These protocols are designed for researchers who intend on generating and using mouse models to study DMD as well as those seeking a detailed framework of phenotyping to contribute to the broader landscape of genetic disorder investigations.
Protocol summary: In this section we present a protocol for CRISPR injection into mouse zygotes to create the ΔEx51 DMD model. Here, we successfully generated guide RNAs (sgRNAs) targeting intronic regions flanking the mouse Dmd target region of exon 51 to create a large intervening deletion.
Image Attribution
BioRender was used to generate figures for this manuscript.
Materials
- NEB HiScribe‱ T7 Quick High Yield RNA Synthesis Kit
- Qiagen RNEasy Mini Kit RNA Cleanup (Qiagen)
- Purified pX459V2 construct (backbone from Addgene Plasmid #62988)
- T7 primer + FWD and REV sequences with overhangs
- NEB Formaldehyde Load Dye
- QIAquick Gel Extraction Kit (Qiagen)
- QIAQuick PCR Purification Kit (Qiagen)
Troubleshooting
Safety warnings
Wear proper PPE (gloves, safety goggles, enclosed shoes and lab coat) and prepare solvents in a chemical fume hood. Dispose used solvents or waste material in an appropriate biohazard waste containers.
Ethics statement
Animal work described in this manuscript has been approved and conducted under the oversight of the Animal Ethics Committee of South Australian Health and Medical Research Institute (SAHMRI) and The University of Adelaide.
Choosing a sgRNA pairing to create the deletion
The in-silico design of guide RNAs was conducted through various online guide design tools and narrowed down based on their predicted on-target and off-target activities. Tools that we would recommend for this task include Benchling and CRISPOR (1). The phospho-annealed guide oligos were then cloned into BbsI-linearised pX459V2 plasmid using the Golden Gate Assembly method. Note that ‘CACC’ and ‘AAAC’ overhangs allow the oligos to bind the complementary overhanging DNA at the cut sites in the plasmid created by the BbsI digestion (2). This process yielded two recombinant constructs, each housing the left intron and right intron, respectively.
gRNA 1 (Right Intron)
Position is 156bp away from 3' exon 51
Forward: 5' - GGTCAACCTAACTACAATCA - 3'
Rev comp: 5' - TGATTGTAGTTAGGTTGACC - 3'
Forward oligo: 5' - CACCGGTCAACCTAACTACAATCA - 3'
Reverse oligo: 5' - AAACTGATTGTAGTTAGGTTGACC - 3'
gRNA 2 (Left Intron)
Position is 290bp away from 5' exon 51
Forward: 5' - GTTTATAAGCACAAGTATTG - 3'
Rev comp: 5' - CAATACTTGTGCTTATAAAC - 3'
Forward oligo: 5' - CACCGTTTATAAGCACAAGTATTG - 3'
Reverse oligo: 5' - AAACCAATACTTGTGCTTATAAAC - 3'
PCR amplification of guide template
Note
The oligos used for Forward and Reverse PCRs are seen in Supplementary Table S1. Here is an expanded form:
gRNA 1 (Right Intron)
T7 Guide Primer for Forward PCR:
5' - TTAATACGACTCACTATAGGGTCAACCTAACTACAATCA - 3'
gRNA 2 (Left Intron)
T7 Guide Primer for Forward PCR:
5' - TTAATACGACTCACTATAGGTTTATAAGCACAAGTATTG - 3'
tracrRNA Reverse Primer: 5’ - AAAAGCACCGACTCGGTGCC - 3’
Prepare PCR mix using the T7 Guide Primer for Forward PCR and tracrRNA reverse primer. The T7 promoter is introduced into the template. Add 1 μL of each of the miniprepped recombinant guide plasmids (at ∼1-3 ng/μL) to 1 tube each and 1 μL Ultrapure water to the final tube.
| A | B | |
| Reagent | Amount | |
| Ultrapure water | 12.3 μL | |
| NEB Phusion HF Reaction Buffer (5x) | 4 μL | |
| T7 guide primer (10 μM) | 1 μL | |
| tracrRNA reverse primer (10 μM) | 1 μL | |
| Roche PCR Grade Nucleotide Mix (10 mM) | 0.5 μL | |
| NEB Phusion HF DNA Polymerase (2 U/μL) | 0.2 μL | |
| Total | 19 μL |
Place the tubes in a thermocycler with the following parameters:
| A | B | C | |
| Steps | T7 PHUSION | ||
| 1 | 98°C | 3 min | |
| 2 | 98°C | 15 s | |
| 3 | 60°C | 20 s | |
| 4 | 72°C | 15 s | |
| 5 | Go to step 2 | 32 times | |
| 6 | 72°C | 5 min | |
| 7 | 4°C | ∞ |
PCR amplification of guide template
Make a 1% agarose gel and run 5 μL of the PCR products 40 min @100 V.
Note
Testing to see if the plasmid has the correct insert. Band should be present at approximately 100 bp
Combine the remainder of all PCR reactions with the correct band and perform Qiagen PCR Purification on the mixture. Use NanoDrop to measure concentration of DNA. A260/A280 values should fall in the range of 1.8-2.0.
Note
This is to confirm if the DNA is still present and determine the amount needed for the IVT reaction.
In vitro transcription (IVT)
Transfer 2 μL to a PCR tube for testing later.
Note
We are using the purified PCR product as the template for IVT with the NEB HiScribe™ T7 Quick High Yield RNA Synthesis Kit.
Mix the following reagents in a PCR tube:
| A | B | |
| Reagent | Amount | |
| Ultrapure H2O | Up to 60 μL | |
| IVT gRNA Product | 40 μL | |
| NEB DNase I (RNAse-free) (2 U/μL) | 4 μL | |
| Total | 104 μL |
Note
Degrades DNA
Incubate 15 min @ 37 °C.
Transfer 2 μL to a separate PCR tube for testing later.
Perform Qiagen RNEasy Mini Kit RNA Cleanup, eluting in 30 μL water.
Transfer 2 μL to a separate PCR tube for testing later.
Add 2 μL NEB Formaldehyde Load Dye to each of the 2 μL RNA aliquots set aside.
Place the mixture in a thermocycler with the following parameters:
| Steps | Reagent | Amount | |
| 1 | 85°C | 3 min | |
| 2 | 4°C | ∞ |
Make an RNase-free 1% agarose gel and run RNA aliquots 30 min @ 100 V.
Note
Testing the gRNA has been produced correctly. Bands should be present at >100 bp (RNA will run higher on the gel than DNA when run against a DNA ladder).
Cytoplasmic Injection
On the day of zygote injection, prepare the injection mix as follows:
| A | B | |
| Reagent | Amount | |
| Ultrapure H2O | 10.125 μL | |
| Injection buffer (10x) | 1.5 μL | |
| gRNA 1 | To give 50 ng/μL | |
| gRNA 2 | To give 50 ng/μL | |
| SpCas9 mRNA | To give 100 ng/μL | |
| Total | 15 μL |
Protocol references
1. Concordet JP, Haeussler M. CRISPOR: intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens. Nucleic acids research. 2018;46(W1): W242–W245. doi: 10.1093/nar/gky354
2. Adikusuma, F., Pfitzner, C., & Thomas, P. Q. (2017). Versatile single-step-assembly CRISPR/Cas9 vectors for dual gRNA expression. PloS one, 12(12), e0187236. https://doi.org/10.1371/journal.pone.0187236