Feb 04, 2025
illumina MiSeq Dual Index Amplicon Sequencing Sample Preparation Bacterial 16S rRNA gene
Forked from a private protocol
- Alexander Eiler1,
- Omneya Osman2,
- Anna Szekely3
- 1University of Oslo;
- 2eDNA solutions AB;
- 3Uppsala University
- AQUA at UiO
Protocol Citation: Alexander Eiler, Omneya Osman, Anna Szekely 2025. illumina MiSeq Dual Index Amplicon Sequencing Sample Preparation Bacterial 16S rRNA gene. protocols.io https://dx.doi.org/10.17504/protocols.io.qytdxwn
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: June 14, 2018
Last Modified: February 04, 2025
Protocol Integer ID: 13043
Disclaimer
Use at your own risk
Abstract
Preparation of PCR products for amplicon sequencing
Guidelines
We have a common stock of barcoded primers stored in the -80C freezer number 3. The primers are in an orange box, which box can be found in the position indicated on the following picture:
In the box from 1 to 20 are the forward primers and from 37 to 56 are the reverse primers. The last line has extras from some primers. If you run out of a barcode, check those first before ordering. Check primer ordering file on common server for primer ordering.
Sequence of barcodes to fill in the SampleSheet file for sequencing:
| Index 2 (i5) | Index 2 (i5) Sequence | Index 1 (i7) | Index 1 (i7) Sequence | |
| Illu_N501F | TAGATCGC | Illu_N701R | TCGCCTTA | |
| Illu_N502F | CTCTCTAT | Illu_N702R | CTAGTACG | |
| Illu_N503F | TATCCTCT | Illu_N703R | TTCTGCCT | |
| Illu_N504F | AGAGTAGA | Illu_N704R | GCTCAGGA | |
| Illu_N505F | GTAAGGAG | Illu_N705R | AGGAGTCC | |
| Illu_N506F | ACTGCATA | Illu_N706R | CATGCCTA | |
| Illu_N507F | AAGGAGTA | Illu_N707R | GTAGAGAG | |
| Illu_N508F | CTAAGCCT | Illu_N708R | CCTCTCTG | |
| Illu_N521F | CTTGCTTT | Illu_N709R | AGCGTAGC | |
| Illu_N522F | GGCTTCAA | Illu_N710R | CAGCCTCG | |
| Illu_N523F | AATCGGCA | Illu_N711R | TGCCTCTT | |
| Illu_N524F | GGTTCAAA | Illu_N712R | TCCTCTAC | |
| Illu_N525F | ACTTCGAC | Illu_N733R | GGTATAAG | |
| Illu_N526F | TGACTTGC | Illu_N735R | CAGCTAGA | |
| Illu_N527F | TAGGACCT | Illu_N736R | CCATAGCA | |
| Illu_N528F | GGAGACTT | Illu_N738R | GGTATAGC | |
| Illu_N529F | AGGTTACG | Illu_N739R | GGTTATGC | |
| Illu_N530F | AATTCGCT | Illu_N740R | TAGGCAAG | |
| Illu_N531F | TCAGCTAA | Illu_N741R | TTGTCCAT | |
| Illu_N532F | GCGATATG | Illu_N743R | TCTAGGCA |
Note: the sequence of the reverse barcodes to fill in the SampleSheet is the reverse complement of their sequence of in the primers.
The 1st part of the protocol is performed in the pre-PCR room.
The 2nd part in the post-PCR room.
Never bring back PCR products to the pre-PCR room.
Materials
MATERIALS
Q5 High-Fidelity DNA Polymerase - 100 unitsNew England BiolabsCatalog #M0491S
Protocol materials
Q5 High-Fidelity DNA Polymerase - 100 unitsNew England BiolabsCatalog #M0491S
Q5 High-Fidelity DNA Polymerase - 500 unitsNew England BiolabsCatalog #M0491L
Before start
Put pipettes and tips in the UV chamber for 10 mins.
Clean bench with MQ and EtOH.
Perform the first PCR (triplicates/duplicates of each sample) using Illumina adaptor attached primers that target the gene of your choice. Here we present the protocol using the Bacteria primers 341F and 805RN. For the forward primer cite: Herlemann et al., 2011 and for the reverse primer cite based on: Apprill et al., 2015 but the one here is not exactly as the one in that paper.
Illumina adapter-N4-341F:
5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNCCTACGGGNGGCWGCAG-3’
Illumina adapter-805NR:
5’-AGACGTGTGCTCTTCCGATCTGACTACNVGGGTATCTAATCC-3’
First PCR reactions
| Components | Working conc. | Final conc. | 1 reaction (20 µl) | (N) reactions | ||
| 5xQ5 Reaction Buffer | 5X | 1X | 4 µl | |||
| Forward Primer (illu-ada-341F) | 10 µM | 0.25 µM | 0,5 µl | |||
| Reverse Primer (illu-ada-805NR) | 10 µM | 0.25 µM | 0,5 µl | |||
| dNTPs | 2 mM | 200 µM | 2 µl | |||
| Q5 HF DNA polymerase | 2 U/µl | 0.02 U/µl | 0.2 µl | |||
| Template DNA | 1 µl | |||||
| Nuclease-Free water | 11.8 µl | |||||
| ∑ | 20 µl |
First PCR program
| STEP | TEMP. | TIME | |
| Initial Denaturation | 98oC | 3 minutes* | |
| 20 cycles | 98oC | 10 seconds | |
| 48oC** | 30 seconds | ||
| 72oC | 30 seconds/kb | ||
| Final Extension | 72oC | 2 minutes | |
| Hold | 6oC | ∞ |
* In the latest protocols this was reduced to 30 seconds but in order to have complete denaturation of long high GC genome fragments, we increased it to 3 minutes, which is in accordance with the manufacturers recommendation.
** First temperature ever used was 55C. Then it changed to 62C. We decided on 48 based on suggestion by Anna Szekely. 48C gets unbiased product amounts of non-mismatch and 3-mismatch isolates. If you use this profile cite: addressing PCR biases or effect of annealing temperature
Q5 High-Fidelity DNA Polymerase - 500 unitsNew England BiolabsCatalog #M0491L
Check PCR products with Agarose gel electrophoresis (1%) - optional
Pool PCR duplicate samples together and perform purification with magnetic beads (Agencourt AMPure or similar)- Optional: run Agarose gel electrophoresis (1%)
- A second PCR is conducted for attaching standard illumina handles and index primers
Multiplex_fwd
AATGATACGGCGACCACCGAGA{TCTACAC}-[i5 index] ACACTCTTTCCCTACACGACG
Multiplex_rev
CAAGCAGAAGACGGCATACGAGAT-[i7 index]-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
(We have in total 20 different forward index/barcode primers and 20 different reverse index/barcode primers. By combining both primers (20X20), it can possible to generate 400 tags in one final pool for sequencing. To find the common stock of the barcoded second step primers check the guidelines of this protocol)
Table 2: Second PCR reactions
| Components | Working conc. | Final conc. | 1 reaction (20 µl) | (N) reactions | ||
| 5xQ5 Reaction Buffer | 5X | 1X | 4 µl | |||
| Forward index (i5, illu-N501-N508) | 5 µM | 0.25 µM | 1 µl | |||
| Reverse index (i7, illu-N701-N712) | 5 µM | 0.25 µM | 1 µl | |||
| dNTPs | 2 mM | 200 µM | 2 µl | |||
| Q5 HF DNA polymerase | 2 U/µl | 0.02 U/µl | 0.2 µl | |||
| Template from 1st PCR | 2 µl | |||||
| Nuclease-Free water | 9.8 µl | |||||
| ∑ | 20 µl |
Second PCR program
| STEP | TEMP. | TIME | |
| Initial Denaturation | 98oC | 30 seconds | |
| 15 cycles | 98oC | 10 seconds | |
| 66oC | 30 seconds | ||
| 72oC | 30 seconds/kb | ||
| Final Extension | 72oC | 2 minutes | |
| Hold | 6oC | ∞ |
Check second PCR products with Agarose gel electrophoresis (1%)
00:01:00
Perform purification with magnetic beads (Agencourt AMPure) and (optional) run Agarose gel electrophoresis (1%)
Quantification: using gel analyzer program or PicoGreen assay
Calculate PCR samples concentration and volume before pooling
Pool the PCR samples in equal DNA amount (ng) or for unequal length amplicons, in equal molecule amount (mol).
You will get one tube with a mix of all the samples in it.
To calculate the volume of each sample to be pooled (DNA amount mixing):
- Use the lowest concentration sample to define the minimum amount of DNA (ng) that you have available from a single sample: the DNA concentration (ng/μL) of the lowest concentration sample multiplied with its volume (μL). This will be your target DNA amount for each sample.
- Calculate how many μLs of each sample you need to achieve the target DNA amount: divide the target DNA amount with the concentration of each sample.
- Pipette into one tube the calculated volume of each sample. Aim to use the same pipette for all samples (dilute or pipette multiple times) to avoid pipette calibration errors.
Gel purify the pool and requantify with PicoGreen before submitting to sequencing facility.