Dec 11, 2020

Public workspaceIllumina double-stranded DNA dual indexing for ancient DNA V.1

  • 1Max Planck Institute for Evolutionary Anthropology;
  • 2Max Planck Institute for the Science of Human History;
  • 3Friedrich-Schiller Universität Jena
  • WarinnerGroup
  • MPI EVA Archaeogenetics
Icon indicating open access to content
QR code linking to this content
Protocol CitationRaphaela Stahl, Christina Warinner, Irina Velsko, Eleftheria Orfanou, Franziska Aron, Guido Brandt 2020. Illumina double-stranded DNA dual indexing for ancient DNA. protocols.io https://dx.doi.org/10.17504/protocols.io.bakticwn
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: December 17, 2019
Last Modified: December 11, 2020
Protocol Integer ID: 31091
Keywords: DNA library, NGS, dual-index, ancient DNA, sequencing, nonUDG, double-stranded, DNA, genomic DNA, genomics, palaeogenetics, archaeogenetics, paleogenetics, archeogenetics, aDNA, Illumina, library preparation, nucleic acids, Amplification, PCR, Index Amplification
Abstract
This protocol converts partially completed double-stranded DNA libraries e.g. from:

Non-UDG treated double-stranded ancient DNA library preparation for Illumina sequencing (dx.doi.org/10.17504/protocols.io.bakricv6)

into dual-indexed Illumina libraries ready for sequencing on an Illumina platform. Other variants of the above protocol can also be used.

This protocol includes steps for indexing PCR, clean-up, and post-indexing qPCR. This protocol is modified after Kircher, M., Sawyer, S. & Meyer, M., 2012. Double indexing overcomes inaccuracies in multiplex sequencing on the Illumina platform. Nucleic acids research, 40(1), p.e3. http://dx.doi.org/10.1093/nar/gkr771.
Image Attribution
Christina Warinner
Guidelines
Working in an Ancient DNA Laboratory
- All steps of this protocol prior to PCR amplification should take place in a clean room facility specifically designed for ancient DNA.
- The researcher performing lab work should be dressed in correspondingly suitable lab-wear, such as:
- full-body suit with hood (e.g., Tyvek)
- hairnet
- face mask
- two pairs of clean gloves
- clean shoes
- protective glasses
- Sample processing and buffer/master mix preparation should be carried out in separated work benches with integrated UV irradiation (e.g. Dead Air PCR work bench)
- Surfaces and equipment should be regularly decontaminated with e.g. bleach solution or Thermofisher's DNA AWAY (or similar) and irradiated with UV.

Please see the following for more detailed guidance:

Llamas, B. et al., 2017. From the field to the laboratory: Controlling DNA contamination in human ancient DNA research in the high-throughput sequencing era. STAR: Science & Technology of Archaeological Research, 3(1), pp.1–14. Available at: https://doi.org/10.1080/20548923.2016.1258824.

Working in an Molecular Biology Laboratory
- From PCR amplification onwards, all steps takes place in a standard DNA-based molecular biology lab.
Please keep in mind the safety guidelines of your specific country and institution.
Recommendations include wearing of:
- lab coats
- closed shoes and trousers
- safety glasses
- nitrile or latex gloves

Definitions
Stock-aliquot refers to a personal 'stock' (e.g. in a 50ml Falcon Tube) of reagents you can use across multiple sessions of this protocol. An 'aliquot' refers to a sub-aliquot of the stock, that is used for a single session of this specific protocol.

Protocol Specific Guidelines
This protocol requires the use of two rooms - a dedicated PCR-free ultra-clean library building room and a standard molecular biology lab for qPCR.
Materials
Materials
Reagent0.2 ml PCR stripsEppendorfCatalog #0030124839
ReagentSafe-Lock Tubes 1.5 ml PCR clean DNA LoBindEppendorfCatalog #0030108051
ReagentFrameStar® 480 PCR plate 96 semi-skirted4titudeCatalog #4ti-0951
ReagentAdhesive clear qPCR seal sheetsBiozymCatalog #600238
ReagentEthanol AbsoluteMerck Millipore (EMD Millipore)Catalog #1009831011
ReagentWater Chromasolv PlusMerck MilliporeSigma (Sigma-Aldrich)Catalog #34877-2.5L
ReagentTween-20Merck MilliporeSigma (Sigma-Aldrich)Catalog #P9416-50ML
ReagentdNTPs 25mMThermo ScientificCatalog #R1121
ReagentAdenosine-5 Triphosphate (ATP) - 1 mlNew England BiolabsCatalog #P0756S
ReagentBSA Molecular Biology Grade (20 mg/ml)New England BiolabsCatalog #B9000 S
ReagentPfuTurbo Cx Hotstart DNA PolymeraseAgilent TechnologiesCatalog #600412
ReagentHerculase II Fusion DNA PolymeraseAgilent TechnologiesCatalog #600679
ReagentDyNAmo Flash SYBR Green qPCR KitThermofisherCatalog #F415L
ReagentMinElute PCR Purification KitQiagenCatalog #28006
ReagentEppendorf Tubes 5 ml PCR cleanEppendorfCatalog #0030119460

Primers
Oligo_IDSequence (5'-3')Cocentration
P5_Jen_8nt (µM)AATGATACGGCGACCACCGAGATCTACAC????????ACACTCTTTCCCTACACGACGC10 µM
P7_Jen_8nt (µM)CAAGCAGAAGACGGCATACGAGAT????????GTGACTGGAGTTCAGACGTGTGC10 µM
IS5AATGATACGGCGACCACCGA10 µM
IS6CAAGCAGAAGACGGCATACGA10 µM
???????? indicates a 8 bp long unique index sequence. Primers can be ordered from any company.

qPCR-Standard
  • Custom-ordered standard based on a synthetic 224 bp oligo including primer binding sites for the primer pairs IS7/8 (and IS5/IS6 - this standard is also used for the indexing protocol Illumina double-stranded DNA dual-indexing for ancient DNA) ranging from 109 to 103 DNA copies/µl in serial 1:10 dilutions.

Lab equipment
PCR Thermocycler (e.g. Eppendorf Thermomaster Nexus)
Thermomixer or heatblock (to pre-heat buffers)
Centrifuge 1.5/2.0 ml (e.g. Eppendorf 5424)
Rotor 1.5/2.0ml (e.g. Eppendorf F-45-24-11)
Mini table centrifuge
qPCR machine (e.g. Roche LightCycler® 96 System)
PCR work bench (e.g. AirClean Dead Air PCR Werkbank, 48´´)
UV irradiation box or cross linker (e.g. Vilber Lourmat Bio-Link BLX-254)
Vortex mixer (e.g. Scientific Industries Vortex-Genie® 2)

Generic Reagents
Solution of household bleach (2-6% NaClO, then diluted to a working solution concentration of 0.2-0.5% NaClO)
Thermofisher DNA AWAY
Paper towels or tissues
Safety warnings
Reagents
Household bleach solution (2-6%) diluted to a working concentration of 0.2-0.5 % NaClO in total
- H290 May be corrosive to metals.
- H314 Causes severe skin burns and eye damage.
- H411 Toxic to aquatic life with long lasting effects.
- EUH206 Warning! Do not use together with other products. May release dangerous gases (chlorine). Remove from surface after recommended incubation time with water-soaked tissue.


DNA AWAY
- H314 Causes severe skin burns and eye damage.

Note: Both bleach solutions and DNA AWAY are used for decontamintation. DNA AWAY is less corrosive than bleach and should be preferred for decontamination of sensitive equipments such as surfaces of electric devices.

Guanidinium hydrochloride (GuHCl ) (in PB buffer of Qiagen MinElute kit)
- H302 Harmful if swallowed.
- H332 Harmful if inhaled.
- H315 Causes skin irritation.
- H319 Causes serious eye irritation.

Ethanol
- H225 Highly flammable liquid and vapour.
- H319 Causes serious eye irritation.


Kits
Check manufacturer's safety information for the Qiagen MinElute PCR Purification kit used in this protocol.

Equipment
UV radiation
- UV radiation can damage eyes and can be carcinogenic in contact with skin. Do not look directly at unshielded UV radiation. Do not expose unprotected skin to UV radiation.
- UV emitters generate ozone during operation. Use only in ventilated rooms.


Before start
Planning
This protocol takes 1 day.

During the protocol samples move from the ancient DNA laboratory to a modern molecular biology lab:
Indexing reactions are prepared in the ancient DNA lab, and then closed tubes are transferred to a standard modern molecular biology lab. All PCR amplification must take place in the modern molecular biology lab and NOT in the ancient DNA lab.
Safety information
Do not amplify the index reaction in a cleanroom! This will produce small PCR fragments that are easily aerosolized, and can contaminate all other libraries produced in that room.

Check waste disposal guidance for all reagents in this protocol against your corresponding laboratory regulations.

Preparation of buffers (Qiagen MinElute kit):
  • Add ethanol to PE wash buffer acccording to manufacturer's instructions.
  • Add Tween-20 to EB elution buffer to a final concentration of 0.05% (Tween-20 in EB). This solution is referred to as EBT throughout the protocol.

Equipment
Make sure all necessary equipment is available (see Materials).

Abbreviations
EBT = modified EB-Buffer (MinElute Kit), see Preparation of buffers
HPLC = High Performance Liquid Chromatography (-Grade Water)
PE = PE-Buffer from Qiagen MinElute Kit
PB = PB-Buffer from Qiagen MinElute Kit
UV = Ultraviolet (radiation)

Samples
This protocol uses around Amount36 µL of the remaining eluate after the final qPCR from library preprartion (e.g. dx.doi.org/10.17504/protocols.io.bakricv6), that is stored at Temperature-20 °C in the ancient DNA lab.

Controls
Take along a positive control and 2 negative controls (e.g. all three from the extraction blank control from Ancient DNA Extraction from Skeletal Material - dx.doi.org/10.17504/protocols.io.baksicwe) and the library build control (e.g. from non-UDG treated double-stranded ancient DNA library preparation for Illumina sequencing dx.doi.org/10.17504/protocols.io.bakricv6) to assess the performance of the protocol and the level of background contamination. Consider these three extra samples in your calculations for buffer preparations. To take along the positive controls is optional after you know that the library preparation worked out.

Additional Tips
It is recommended to prepare 10% more of the calculated volume of all mastermixes to compensate for possible pipetting error.
Indexing preparation (aDNA library preparation room)
Indexing preparation (aDNA library preparation room)
Calculate the total number of DNA molecules (total copy number) DNA concentration in each library based on qPCR performed at the end of library preparation (see Before Start). Do not use more than 1.5x10^10 copies per indexing reaction. Adjust the amount of DNA used per reaction based on the initial library quantification. Depending on the total amount of DNA, split the indexing PCR into 2, 4, or 6 reactions per library.
Note
The number of indexing reactions per library depends on the DNA concentration of the library, which comes from the qPCR run at the end of library preparation (see Before Start).

Note
If the total copy number is high enough that six splits are not sufficient to bring the number of DNA copies per reaction to 1.5x10^10, then calculate the amount of splits nessesary to stay below this threshold. Divide the total volume of the library (Amount36 µL ) by the number of splits to know the maximum input volume of library per index reaction. Set up a maximum of six indexing reactions. Keep the remaining DNA-Library as a backup at Temperature-20 °C .


Store all remaining libraries eluates in the freezer at Temperature-20 °C for short-term storage (1-2 months) or the Temperature-80 °C freezer for long-term storage.

Assign unique dual index combinations of index primer pairs to each library.
Critical
Splits: 2 (aDNA library preparation room)
Splits: 2 (aDNA library preparation room)
Calculate the amount of master mix needed for the number of samples being processed. Prepare the master mix according to the table below within a 1.5 mL LoBind tube.

Add Amount78 µL mastermix, Amount2 µL of each index primer and Amount18 µL sample to each tube (use 0.2 mL PCR strips).

ReagentStock ConcentrationFinal concentration1× Volume [µl]
Pfu Turbo Buffer10 ×1 ×10.0
BSA20 mg/mL0.3 mg/mL1.5
dNTPs25 mM each0.25 mM each1.0
Pfu Turbo Polymerase2.5 U0.025 U1.0
Index P5_Jen_8nt10 µM0.22.0
Index P7_Jen_8nt10 µM0.2 µM2.0
UV HPLC-water--64.5
DNA or UV HPLC-water--18.0
Total100.0

Note
Each library will have 2 reactions of Amount100 µL each.


Splits: 4 (aDNA library preparation room)
Splits: 4 (aDNA library preparation room)
Calculate the amount of master mix needed for the number of samples being processed. Prepare the master mix according to the table below within a 1.5 mL LoBind tube.

Add Amount87 µL mastermix, Amount2 µL of each index primer and Amount9 µL sample to each tube (use 0.2 mL PCR strips).

ReagentStock conconcentrationFinal concentration1× Volume [µL]
Pfu Turbo Buffer10 ×1 ×10.0
BSA20 mg/mL0.3 mg/mL1.5
dNTPs25 mM0.25 mM1.0
Pfu Turbo Polymerase2.5 U0.025 U1.0
Index P5_Jen_8nt10 µM0.2 µM2.0
Index P7_Jen_8nt10 µM0.2 µM2.0
UV HPLC-water--73.5
DNA or UV HPLC-water--9.0
Total100.0

Note
Each library will have 4 reactions of Amount100 µL each.





Splits: 6 (aDNA library preparation room)
Splits: 6 (aDNA library preparation room)
Calculate the amount of master mix needed for the number of samples being processed. Mix the master mix from the table below in a 1.5 mL LoBind tube.

Add Amount90 µL mastermix, Amount2 µL of each index primer and Amount6 µL sample to each tube (use 0.2 ml PCR strips).

ReagentStock concentrationFinal concentration1× Volume [µl]
Pfu Turbo Buffer10 ×1 ×10.0
BSA20 mg/mL0.3 mg/mL1.5
dNTPs25 mM each0.25 mM each1.0
Pfu Turbo Polymerase2.5 U0.025 U1.0
Index P5_Jen_8nt10 µM0.2 µM2.0
Index P7_Jen_8nt10 µM0.2 µM2.0
UV HPLC-water--76.5
DNA or UV HPLC-water--6.0
Total100.0

Note
Each library will have 6 reactions of Amount100 µL each.


Move to modern DNA lab
Move to modern DNA lab
Securely close the reactions and transfer to modern DNA laboratory. If possible, keep the reactions on ice during the transfer.
Indexed adapter ligation with PCR (modern DNA lab)
Indexed adapter ligation with PCR (modern DNA lab)
In a modern DNA lab, use a thermocycler to amplify the reactions with the following program:

TemperatureTime
95°C2 minInital denaturation
95°C30 sec10 cycles
58°C30 sec
72°C1 min
72˚C10 minFinal elongation
10˚Cuntil further processing

Note
During this incubation, label new 1.5mL LoBind tubes for post-purification elution (step 10).


MinElute Purification (modern DNA lab)
MinElute Purification (modern DNA lab)
Purify the indexed libraries with a MinElute kit, with the following modifications to the manufacturer's protocol.
For each reaction, add Amount650 µL PB (binding) buffer to a new 5 mL LoBind tube. Add the library, then vortex briefly to mix. A single column can be used for up to 4 index reactions of one library. Therefore, each PB and library mix of a single library that was split in 2 to 4 reactions will be loaded onto the same column.

Note
If 6 or more splits were performed for the indexing reactions, the PB and library mix can be split over 2 columns for purification. In this case, elute the DNA from each column in step 8.8 with Amount25 µL EBT and combine the eluate to get Amount50 µL .


Mix
Load each reaction (PB buffer + library) onto a MinElute column and incubate at RT for Duration00:02:00 .

Note
This allows sufficient time for the DNA to bind to the silica membrane.

Spin at Centrifigation15800 x g, 00:01:00 and discard flow-through.


Note
Pour off the liquid into a waste tube, and pat the rim of the collection tube dry on a paper tissue or towel. Use just one spot on the paper tissue per sample. Be careful not to touch the rim of the tube on the waste container. After you are finished with all samples, discard the paper and wipe clean the surface underneath with water and soap.

Add Amount700 µL PE (wash) buffer to the MinElute column.

Spin at Centrifigation15800 x g, 00:01:00 and discard flow-through.

Dry spin at Centrifigation15800 x g, 00:01:00 .

Remove columns from their collection tubes and place them in new 1.5 mL LoBind tubes.
Add Amount50 µL EBT to the column of the filter, let stand for Duration00:01:00 , then spin at Centrifigation15800 x g, 00:01:00 to elute.

Note
Carefully pipette EBT directly onto the center of the membrane without touching the membrane.

Note
If two columns were used for the purification of one library, elute each in Amount25 µL and pool both reactions to produce a total elution volume of Amount50 µL .

qPCR Quality Check (modern DNA facility)
qPCR Quality Check (modern DNA facility)
Dilute Amount2 µL of the indexed library 1:1000 for qPCR. Do this in 2 steps: Make a 1:10 dilution, and then make a 1:100 dilution of the 1:10 dilution, for a final dilution of 1:1000.

Prepare a qPCR assay calculating Amount20 µL /reaction . Prepare 2 reactions per sample, plus 16 additional reactions for 7 qPCR standards in duplicates and 2 qPCR blanks.


ReagentStock concentrationFinal concentration1× Volume [µl]
DyNAmo Master Mix2 ×1 ×10
IS5 primer10 µM0.5 µM1
IS6 primer10 µM0.5 µM1
HPLC-Water (non UVed)--7
DNA or HPLC-Water (1:1000 dilution)--1
Total20
Do not add the DNA dilutions to the mastermix.

Note
Important Do NOT vortex the DyNAmo MasterMix, it will create bubbles that are very difficult to remove. The bubbles will interfere with the qPCR measurements. Gently pipette the DyNAmo MasterMix to equally distribute the fluorescent dye.

Gently pipette the qPCR master mix, or gently invert the tube several times to mix. Again avoid vortexing so you do not create any bubbles.

Add Amount19 µL mastermix and Amount1 µL diluted libraries, standard, or water for each reaction to a fresh 96-well plate.

Note
Be sure to check that the reactions do not contain bubbles, because this will affect the qPCR readings and subsequent downstream calculations. If bubbles are present, briefly centrifuge the plate at maximum speed to remove them.

Amplify the qPCR reactions with the following program:

TemperatureTime
95°C10 minInital denaturation
95°C30 sec40 cycles
60°C1 min
72°C30 sec
60-95˚CMelting curve
Finally hold the reactions at 37°C.

Note
The number of DNA copies determined with this qPCR is used to determine the amount of sample used as input for final amplification and pooling for sequencing (separate protocol).