Sep 03, 2021

Public workspaceHybridization of RNA Probes

Book Chapter
Hybridization of RNA Probes
  • Jonathan Houseley,
  • Cristina Cruz
  • Springer Nature Books
Icon indicating open access to content
QR code linking to this content
Protocol CitationJonathan Houseley, Cristina Cruz 2021. Hybridization of RNA Probes. protocols.io https://dx.doi.org/10.17504/protocols.io.bns4megw
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: October 23, 2020
Last Modified: September 03, 2021
Protocol Integer ID: 43580
Keywords: lncRNA, ncRNA, northern blot, hybridization, probes, hybridization of rna probe, agarose gels of glyoxylated rna, using rna probe, rna probe, rna on agarose gel, glyoxylated rna, analysis of high molecular weight rna, noncoding rna, molecular weight determination of rna, rna on polyacrylamide, resolution separation of small rna fragment, separated rna, rna research, processing of ncrna, stranded rna, high molecular weight rna, detailed insights into complex rna population, explosion in rna research, studying rna processing, unsurpassed insights into ncrna distribution, rna processing analysis, rna processing, rna, complex rna population, radioactive probing of rna membrane, methods for routine mrna quantification, sequencing gel electrophoresi, effective rna denaturant, specialist rna research group, small rna fragment, rna species, rna isoform, source of rna, routine mrna quantification, rna membrane, standard protein gel electrophoresis system, rna form, rna processing by complex, gel electrophoresi, sequencin,
Abstract
Over the past decade a plethora of noncoding RNAs (ncRNAs) have been identified, initiating an explosion in RNA research. Although RNA sequencing methods provide unsurpassed insights into ncRNA distribution and expression, detailed information on structure and processing are harder to extract from sequence data. In contrast, northern blotting methods provide uniquely detailed insights into complex RNA populations but are rarely employed outside specialist RNA research groups. Such techniques are generally considered difficult for nonspecialists, which is unfortunate as substantial technical advances in the past few decades have solved the major challenges. Here we present simple, reproducible and highly robust protocols for separating glyoxylated RNA on agarose gels and heat denatured RNA on polyacrylamide–urea gels using standard laboratory electrophoresis equipment. We also provide reliable transfer and hybridization protocols that do not require optimization for most applications. Together, these should allow any molecular biology lab to elucidate the structure and processing of ncRNAs of interest.

Introduction

Northern blotting methods allow for simultaneous quantification and molecular weight determination of RNA. Although superseded by qPCR and sequencing methods for routine mRNA quantification, northern blotting is the method of choice when complex mixtures of overlapping species are under investigation. This is particularly true when studying RNA processing by complexes such as the exosome, and generally aids in resolving the behavior of differentially expressed RNA isoforms. Historically, northern analysis has been something of a black art; running a high-quality formaldehyde gel required substantial skill and a little luck, while radioactive probing of RNA membranes often resulted in terrible cross-hybridization and invisible signals. Fortunately, technology has moved on such that modern northern analysis methods are simple and robust.
Electrophoretic separation of single-stranded RNA is more complex than double-stranded DNA as RNA forms strong secondary structures that impede separation by molecular weight in a gel matrix. For analysis of high molecular weight RNA in agarose gels, chemical modification of guanine is the preferred method to melt secondary structure, which disrupts C:G base pairing and allows single stranded RNA to migrate according to size. Although formaldehyde has been widely used for this purpose [1], it is not ideal due to issues with sample migration and batch-to-batch variation. Furthermore formaldehyde gels release toxic formaldehyde gas; this did not overly concern early investigators eager to replace the hideously toxic denaturant methyl mercury used in the first northern blotting protocols [2,3], but is clearly a problem in modern labs. To circumvent these issues glyoxal was long ago suggested as an effective RNA denaturant [4], but originally required technically awkward buffer recirculation. This problem was solved by the introduction of BPTE running buffer, which allows agarose gels of glyoxylated RNA to be run with no more difficulty than a normal DNA agarose gel [5].
High-resolution separation of small RNA fragments (~20–250 bp) is best performed on denaturing acrylamide gels, which rely on heat and urea rather than chemical modification to prevent secondary structure formation. The technique is identical to traditional sequencing gel electrophoresis [6], however, the apparatus used for sequencing is not practical for northern blotting and standard protein gel electrophoresis systems are well-suited for this purpose. Helpfully, many of the complications inherent to running a high quality sequencing gel can be safely ignored unless base-pair resolution is required.
Separated RNA is transferred to a membrane by capillary transfer for agarose gels or using an electroblotting system for acrylamide gels [7,8,9]. Various different membranes and transfer conditions have been described but we find charged nylon membrane best for all standard applications [10], and observe little difference between transfer methods. Similarly, many combinations of probes and hybridization buffers can be used to detect RNA species, each having their own strengths and weaknesses. Here we provide a protocol for using RNA probes transcribed from PCR products; in our hands these are both the most reliable and the most sensitive, and as such are the probe of choice for new users [11,12,13,14]. We also provide probing conditions for use of synthetic oligonucleotides, which are widely used in RNA processing analysis since they provide unparalleled resolution of intermediates, and for random-primed DNA probes.
The source of RNA used for northern blotting is rarely critical as long as it is of high quality (see Note 1), and therefore in this chapter we focus purely on the gel systems and hybridization methods.
Guidelines

RNA Handling and RNase-Free Technique

The difficulties in handling RNA are often overemphasized. In our hands, most of the cumbersome procedures recommended for avoiding RNase contamination seem to be dispensable. We use tubes and water specifically designated for RNA work, but take few other precautions. Solutions for gels and blotting are made with milliQ water in normal lab bottles with standard chemicals weighed in disposable weighing boats. We do not DEPC treat water or solutions, or use RNase decontaminating sprays or wipes routinely. It is good to have RNase ZAP in the laboratory to clean occasional contaminations or to wipe for example tissue grinding tools that will be in direct contact with the sample. For the final resuspension of RNA samples, we use commercially available nuclease free water. On first use, electrophoresis tanks can be rendered RNase-free by treating with 3% H2O2for 10 min, then rinsed with milliQ water, then set aside for RNA work if required. Blotting and hybridization can be carried out in normal laboratory trays and glassware. We use certified RNase-free filter tips and set aside a specific set of pipettes for handling stocks of RNase and RNase-containing solutions like plasmid miniprep resuspension buffer. Our bodies are a good source of RNase contamination, so care should be taken to avoid touching the inside of the lids when handling tubes. After assembling reagents, solutions and equipment for northern blotting, it is advisable to run a test gel using RNA of known quality before handling precious samples; ribosomal RNA bands should be clearly resolved and the higher molecular weight band (28S in mammals, 25S in yeast) should be brighter than the lower band (18S). This will confirm that the reagents are sufficiently RNase free.

Conversely, nonenzymatic mechanisms of RNA degradation need to be considered: RNA hydrolysis is catalyzed by alkaline pH and/or divalent cations, particularly with increasing temperature. Therefore, store RNA in water as opposed to TE (pH 8) or similar and beware of reaction conditions involving divalent cations and heat. DNase treatment can be a problem as all DNase I buffers contain magnesium, and DNase treatment is rarely necessary for northern blots as high molecular weight genomic DNA usually resolves far from the bands of interest.
Materials

RNA Handling and RNase-Free Technique

1. A source of RNase-free milliQ water.
2. Commercially available nuclease free water.
3. Certified RNase-free filter tips.
4. 1.5 mL microfuge tubes specifically designated for RNA work.
5. A set of pipettes that are RNase-free.
6. RNaseZAP (Sigma) or similar.
7. 3% H2O2.

Hybridization of RNA Probes

1. Gel purified probe template DNA.
Note
Antisense RNA probes should be 100–500 bp, and are transcribed from PCR products with a T7 promoter at the 5′ end (Fig.3and Table2). To include the T7 promoter in the PCR product, simply fuse this sequence to the 5′ end of the forward primer GGATCCTAATACGACTCACTATAGGGAGAGGA (seeFig.3). It is critical to amplify the probe template using a polymerase such as Phusion that does not leave 3′ A overhangs. The probe should be gel purified from a 50 μL PCR product and eluted in 30 μL.

2. 100 μM rUTP.
3. 10 mM rCTP/rGTP/rATP mix.
4. 100 mM DTT.
5. 10 mg/mL BSA.
6. 20 U/μL T7 RNA polymerase and transcription buffer (Promega).
Note
T7 tolerates low concentration labelled nucleotides better than T3 or SP6.

7. Radioactive workroom and protective equipment.
8. 3000 Ci/mMol [α-32P] UTP, 370 MBq/mL.
Note
32P sources do not need to be particularly fresh. We use sources up to 6 weeks past the activity date with no problem, or even more for high signals. The exposure time required obviously increases, but the output is similar.

9. Hybridisation bottles and rotisserie oven.
10. ULTRAHyb ultrasensitive hybridisation buffer by Ambion (Thermo Fisher Scientific).
Note
It is good practice to split the ULTRAHyb buffer into 4 aliquots and store at 4 °C. For highly abundant transcripts, a lower sensitivity hybridization is advisable using Church Hybridization buffer instead. Church Hybridization buffer: 0.17 M Na2HPO4,0.079 M NaH2PO4(moles not g given as hydration state of stocks varies widely), 35 g SDS, 1 mL 0.5 M EDTA, milliQ H2O to 400 mL. Warm to dissolve, and then cool to room temperature. pH should be ~7.2. Dissolve 5 g of BSA in 100 mL of milliQ H2O and add slowly to the previous solution while stirring. Aliquot and store at −20 °C.

11. mini Quick Spin DNA Columns by Roche or similar.
12. 0.1× SSC 0.1% SDS.
13. 6× SSC.
14. Typhoon Storage Phosphorimager FLA7000 (GE) or equivalent.
15. Storage phosphor screen and exposure cassette.
16. FLA image eraser (GE) or equivalent.
Troubleshooting
Safety warnings
Please refer to the Safety Data Sheets (SDS) for health and environmental hazards.

IMPORTANT: Make sure you have appropriate training to work with radioactivity under the local rules and legislation for your institution, and perform all radioactive work in the designated area.
Before start
It is recommended to read through the guidelines before starting any work with RNA.
Hybridization of RNA Probes
6h 20m

Safety information
IMPORTANT: Make sure you have appropriate training to work with radioactivity under the local rules and legislation for your institution, and perform all radioactive work in the designated area.

Ensure that the hybridization bottles and internal seals are in good condition to avoid radioactive buffer leaking during hybridization.
Prewarm a bottle of ULTRAHyb to Temperature68 °C until the SDS fully dissolves (Duration00:15:00 Duration00:20:00 ).

35m
Wet the membrane with 0.1× SSC 0.1% SDS. Roll it up with the RNA facing inward, drop it into the hybridization bottle and slowly turn the bottle to unroll the membrane against the side of the bottle.
Note
A Stripette can be used to help with this. Push out any obvious air bubbles. Put bottles in the oven so that the visible edge of the membrane is moving with the direction of rotation; if the membrane rolls up into a thin cigar during hybridization or washing then it was the wrong way round. When using a hybridization oven with rotisserie, always be sure to balance the bottles, including the volume of liquid inside. Two membranes can be hybridized in the same bottle, one facing the glass and the other facing the inside of the bottle.

Prehybridize for Duration01:00:00 at Temperature65 °C with Amount7.5 mL ULTRAHyb .
Note
This is an important step so do not feel tempted to skip it or shorten it. It allows blocking agents in the hybridization buffer to occupy nonspecific binding sites.

Note
In our hands, 65 °C is the best temperature for almost all RNA probes. However, if cross-hybridization to ribosomal RNA is observed, increase the prehybridization, hybridization, and washing temperatures to 68 °C. Beware that this is often caused by the oven temperature calibration drifting such that the oven is not actually at the set temperature of 65 °C. Leave a beaker of water overnight in the oven and check the temperature with a trustworthy thermometer to be sure. In contrast, if the probe is unavoidably AT rich (such as the probe used in Fig.2d) and a very low signal is obtained, reduce the prehybridization, hybridization and washing temperature to 60 °C and hybridize again with the same probe. Further temperature optimization is unlikely to improve the signal.

1h
Critical
To make the probe, mix the following reagents in the given order at TemperatureRoom temperature in a 1.5 mL screw cap tube:
Amount5 µL gel purified template (the absolute amount does not seem to be critical).
Amount0.6 µL 100 μM rUTP
Amount3.7 µL milliQ H2O
Amount1 µL 10 mM rCTP/rGTP/rATP
Amount2 µL 100 mM DTT
Amount0.2 µL 10 mg/mL BSA
Amount4 µL 5× transcription buffer
Amount2.5 µL 3000 Ci/mMol [α-32P] rUTP
Amount1 µL T7 RNA polymerase
Note
Some cold UTP is important otherwise the in vitro transcription is inefficient. However, more cold UTP means that the radioactivity per probe molecule is lower, reducing the signal. This amount is a compromise, try not to change unless absolutely necessary.

Note
It is critical that the polymerase is added after the radioactive rUTP, then mixed well.

Mix well and incubate Duration01:00:00 Duration02:00:00 at Temperature37 °C .
Note
In our hands Duration02:00:00 or more of labeling is fine.

3h
Incubation
Mix
Flick a mini Quick Spin column inverted and then correct way up to get the sepharose to the bottom, remove top then bottom cap (see product instructions).
Place the column in a 2 mL microcentrifuge tube, spin at Centrifigation1000 x g, 00:00:30 , discard tube and place the column in a new 1.5 mL screw cap tube.

Centrifigation
Dilute the probe with water to Amount50 µL and then pipette carefully on to the center of the sepharose matrix in the column.

Pipetting
Centrifuge at Centrifigation1000 x g, 00:04:00 .

Centrifigation
Test incorporation by briefly holding the probe and column at equal distances from the Geiger counter. Use tweezers for this. At least 50% of the label should be incorporated, which means the Geiger counter will read the same signal from both column and probe. Discard the column to the radioactive waste.
Add the probe to the hybridization bottle while vertical so that it falls directly into the hybridization buffer, and continue to rotate at Temperature65 °C DurationOvernight .
2h
Overnight
Pour the probe into a 50 mL tube (Falcon/Corning type) and store at Temperature-20 °C .
Note
RNA probes and oligonucleotide probes can be reused up to 2 times (a total use of 3 times) but only over a week or two taking into account the half-life of the isotope. To reuse a probe, prehybridize the membrane with half the normal quantity of hybridization buffer, meanwhile defrost the probe by letting the tube stand in a beaker of hot water for 20 min then pour the probe into the hybridization bottle.

Pause
Pour ~Amount50 mL 6× SSC in the bottle, close tightly and shake gently then pour off the wash solution. (1/2)
Note
The washes with 6× SSC are the low stringency washes. After the probe is poured off, the blot is washed repeatedly with low stringency wash buffer (high salt) to remove unbound probe.

Wash
Pour ~Amount50 mL 6× SSC in the bottle, close tightly and shake gently then pour off the wash solution. (2/2)

Wash
Add Amount50 mL 6× SSC , return the bottle to the hybridization oven and rotate at Temperature65 °C for at least Duration00:20:00 . Make sure the bottle is balanced by another also containing Amount50 mL liquid .

20m
Wash
Pour off the 6× SSC and add Amount50 mL prewarmed (65 °C) 0.1× SSC, 0.1% SDS , return to hybridization oven and rotate at Temperature65 °C for Duration00:20:00 . (1/2)
Note
The washes with 0.1× SSC 0.1% SDS are the high stringency washes. The blot is washed 2–3 times with high stringency wash buffer (low salt) at high temperature to remove nonspecifically bound probe.

20m
Wash
Pour off the 6× SSC and add Amount50 mL prewarmed (65 °C) 0.1× SSC, 0.1% SDS , return to hybridization oven and rotate at Temperature65 °C for Duration00:20:00 . (2/2)
20m
Wash
Pour off the remaining buffer, and use tweezers to pull the membrane out of the bottle onto a paper towel.
Note
To clean the bottle, simply rinse with water and give it a wipe with a paper towel to remove residual counts. The lids are harder to clean: run water into the lid (hopefully this will dislodge the rubber seal), and wipe inside with a paper towel. Do not attempt to prise the seal out as this can damage the seal, leading to leaks during future hybridization. It is often not possible to completely decontaminate hybridization bottle lids, so we always treat them as if contaminated. With careful handling, the bottles, lids, and seals last for many years.

Pat lightly to leave semidry. It is wise to do this behind a Perspex shield as membranes sometimes carry a substantial amount of radioactivity.
Wrap the membrane in Saran Wrap.
Check the signal with a Geiger counter to obtain an estimated exposure time.
Note
If the exposure time needs to be adjusted, the phosphor screens can be blanked and reexposed. For very intense signals (thousands of counts per second) the phosphor screen may need to be exposed to natural UV light for several days to fully blank the signal (i.e., leave it on the windowsill!).

Table 1
Storage phosphor screen exposure time guidelines
ABC
Counts per secondExposure time (h)Quality
<5024Able to see and quantify but poor quality
36More sensitive and good quality
50–4002Able to see and quantify but poor quality
48Good quality
96Over exposed (will impede quantification)
>4002Good quality
Table 1
Storage phosphor screen exposure time guidelines

Expose the membrane to a storage phosphor screen in a cassette. The screen should be blanked just before use as it will expose slowly with time.