Mar 25, 2018
Human rhinovirus screening real-time RT-PCR ("modified Lu assay")
- 1The University of Queensland
Protocol Citation: Ian M Mackay 2018. Human rhinovirus screening real-time RT-PCR ("modified Lu assay"). protocols.io https://dx.doi.org/10.17504/protocols.io.nz4df8w
Manuscript citation:
Ref 1.
Real-Time Reverse Transcription-PCR Assay for Comprehensive Detection of Human Rhinoviruses.
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2238069/
Ref 2.
Newly identified human rhinoviruses: molecular methods heat up the cold viruses.
https://onlinelibrary.wiley.com/doi/abs/10.1002/rmv.644
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We used this protocol up until 2015, and it worked brilliantly.
Created: March 25, 2018
Last Modified: March 28, 2018
Protocol Integer ID: 11036
Abstract
This is an excellent rhinovirus screening assay which I have used on thousands of sample extracts mostly originating from acutely ill paediatric patients, spanning well over a decade's worth of collection dates.
I have not confirmed that it can detect every single genotype but I do know that it detects many from each of the three RV species (Human rhinovirus A, Human rhinovirus B and Human rhinovirus C) as well as at least some Human enterovirus genotypes.
The assay does pick up some enteroviruses due to their genetic similarities in the 5'UTR target region. These can be discriminated using subgenomic sequencing (see VP42 typing assay protocol), or simply described as "respiratory enteroviruses" since there is no specific-specific vaccine or treatment available anyway.
The assay was created and first described in 2008 by Xiaoyan Lu and colleagues at the US CDC [Ref 1]. In collaboration with Lu et al., we published a small update that included Lu's modified forward primer design. We routinely use it with this primer (hence the 'mod' text added to the primer name) but without the expensive special base, as outlined in Step 1.
Materials
MATERIALS
SensiFAST Probe no ROX one-step kitBiolineCatalog #BIO-76005
STEP MATERIALS
SensiFAST Probe no ROX one-step kitBiolineCatalog #BIO-76005
SensiFAST Probe no ROX one-step kitBiolineCatalog #BIO-76005
Protocol materials
SensiFAST Probe no ROX one-step kitBiolineCatalog #BIO-76005
SensiFAST Probe no ROX one-step kitBiolineCatalog #BIO-76005
SensiFAST Probe no ROX one-step kitBiolineCatalog #BIO-76005
SensiFAST Probe no ROX one-step kitBiolineCatalog #BIO-76005
Before start
If using a different brand or model of real-time thermocycler, check the concentration of ROX is adequate.
Method assumes the user is familiar with the thermocycler and software used to run the protocol.
Oligonucleotide sequences
Oligonucleotide sequences
| Name | Sequence (5'-3') | |
| panHRV_LU_01_ mod2 | CY+AGCC+TGCGTGGY | |
| panHRV_02.2 | GAAACACGGACACCCAAAGTA | |
| panHRV_TM | TCCTCCGGCCCCTGAATGYGGC |
- The original Lu et al. forward primer [Ref 1] was modified [Ref 2].
- We do not use the 'P' originally designated at the 'Y' position [see Ref 1 for details]. This is an expensive pyrimidine derivative degeneracy that mimics a C/T mix
- The '+' represents an LNA 'A' or 'T' base
- The naming used here is my in-house adaptation (FYI: 01 - forward / sense; 02 - reverse / antisense; .x - version of the design of this particular named oligonucleotide). If you prefer to be true to the original publication, please see Ref 1 and Ref 2.
Reagents
Reagents
SensiFAST Probe no ROX one-step kitBiolineCatalog #BIO-76005
Reaction set-up
Reaction set-up
The assay has been used on both a Rotor-Gene 6000 and a Rotor-Gene Q real-time thermocycler
Prepare sufficient mix for the number of reactions.
Include a suitable 'dead volume' as necessary if using a robotic dispenser.
| Reagent | Vol. (ul) x1 | Final reaction concentration | |
| Nuclease-free water | 0.8 | N/A | |
| SensiFAST no ROX One-Step Mix(2X) | 10 | 1X | |
| Primers (2μM)1 | 4 | 400nM | |
| Probe (2μM) | 1 | 100nM | |
| MgCl2 (25mM) | 1.6 | 5mM | |
| RNase inhibitor | 0.4 | Unknown | |
| RT (?U/μl) | 0.2 | Unknown | |
| Template | 2 | N/A |
- Both mixed tot his final concentration
- Dispense 15µL to each reaction well.
- Add 5µL of template (extracted RNA, controls or NTC [nuclease-free water] )
- Total reaction volume is 20µL
Amplification
Amplification
| 45°C | 20min | 1X | |
| 94°C | 2min | 1X | |
| 94°C | 5sec | | 55X | |
| 60°C | 60sec* | | |
*Fluorescence acquisition step
Result analysis
Result analysis
The definition used for a satisfactory positive result from a real-time fluorogenic PCR should include each of the following:
1. A sigmoidal curve – the trace travels horizontally, curves upward, continues in an exponential rise and followed by a curve towards a horizontal plateau phase
2. A suitable level of fluorescence intensity as measured in comparison to a positive control (y-axis)
3. A defined threshold (CT) value which the fluorescent curve has clearly exceeded (Fig.1 arrow), which sits early in the log-linear phase and is <40 cycles
A flat or non-sigmoidal curve or a curve that crosses the threshold with a CT >40 cycles is considered a negative result. NTCs should not produce a curve.
Figure 1. Examples of satisfactory sigmoidal amplification curve shape when considering an assay’s fluorescent signal output. The crossing point or threshold cycle (CT) is indicated (yellow arrow); it is the value at which fluorescence levels surpass a predefined (usually set during validation, or arbitrary) threshold level as shown in this normalized linear scale depiction. LP-log-linear phase of signal generated during the exponential part of the PCR amplification; TP-a slowing of the amplification and accompanying fluorescence signal marks the transition phase; PP-the plateau phase is reached when there is little or no increase in fluorescent signal despite continued cycling.