May 22, 2024

HTTM : Illumina library preparation V.3

  • 1Université de Sherbrooke
Icon indicating open access to content
QR code linking to this content
Protocol CitationAntoine Champie, Amélie De Grandmaison, Sebastien Rodrigue 2024. HTTM : Illumina library preparation. protocols.io https://dx.doi.org/10.17504/protocols.io.n2bvj8oowgk5/v3Version created by Antoine Champie
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: May 21, 2024
Last Modified: May 22, 2024
Protocol  Integer ID: 100197
Keywords: illumina library preparation part of the httm protocol, sequencing library, illumina library preparation part, preparation of illumina, sequencing, httm protocol, illumina, part of the httm protocol
Abstract
Part of the HTTM protocol dedicated to the preparation of Illumina sequencing libraries.
Attachments
Image Attribution
Make with BioRender.com
Materials
Preparation of Nextera Adaptaters :

Nextera (NxT) adapters are prepared by hybridisation of the following primers :

AB
Nxt-XTv2-B-N701-TCAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGT
Nxt-XTv2-B-3R-ac3-5phos/5Phos/CTGTCTCTTATACACATCTCCGAGCCCACGAGAC/3InvdT/

  • Preparation of the 5X annealing buffer (5X Tris NaCl buffer : 50 mM Tris, pH 7.5-8, 250 mM NaCl) :
  • 500 µl Tris-HCl 1M pH 7.5
  • 500 µl NaCl 5M
  • 9 ml H2O mol.-grade

  • Preparation of the adapters (40 µM 50 µL) :
  • Resuspend both primers in water to obtain 100 µM stocks
  • Mix 20 µl of each (Nxt-XTv2-B-N7XX-T and Nxt-XTv2-B-3R-ac3-phos5’)
  • Add 10 µl of 5X annealing buffer
  • Annealing reaction in a thermocycler (decrease temperature from 98 to 4C (-0.1C/cycle(10s/cycle)))



Primers used for the first PCR :
AB
Nxt_AAATGATACGGCGACCACCGAGATCTACAC
Nxt_BCAAGCAGAAGACGGCATACGAGAT
Primers template for barcoding PCR :
AB
Nxt_i5_barcodingAATGATACGGCGACCACCGAGATCTACAC [8 Nu Index] TCGTCGGCAGCGTCAGATGTGTA
Nxt_i7_barcodingCAAGCAGAAGACGGCATACGAGAT [8 Nu Index] GTCTCGTGGGCTCGGAGATGTGTATAAG
Before start
All steps and master mixes need to be kept on ice as much as possible. Thermocyclers need to be cooled at 4C before inserting sample plate.
Libraries
1h 34m
Transfer 2.5 µL of DNA from the DNA extraction plate to a new PCR plate.

Prepare a fragmentation master mix for 96 samples with :

AB
NEB Ultra II FS buffer77 µl
NEB Ultra II FS enzyme22 µl
Molecular grade water11 µl

Add 1 µL of the fragmentation master mix to each well.

Incubate in a thermocycler with the following protocol :
  • 00:15:00 at 37 °C
  • 00:30:00 at 65 °C




45m
Add 1 µL of 4µM Nextera (NxT) adaptors to each well.

Prepare a ligation master mix for 96 samples with :
AB
NEB Ultra II ligation master mix 377.4 µl
NEB Ultra II ligation enhancer12.1 µl

Add 3.5 µL of ligation master mix to each well.

Incubate in a thermocycler with the following protocol :
  • 00:30:00 at 20 °C
  • 00:10:00 at 65 °C

40m
Prepare a PCR master mix with :

AB
NxT_A primer 10 µM883 µl
NxT_B primer 10 µM883 µl
Molecular grade water7507 µl
PCR Mix 2X11040 µl

Add 92 µL of PCR master mix to each well.

Split the PCR reaction into 2 different plates (50 µl per plate).
Incubate each plate in a thermocycler with the following cycles :
  • 00:00:30 at 98 °C
  • 00:00:15 at 98 °C
  • 00:00:30 at 72 °C
  • Repeat from step 2 for 20~25 cycles*
  • 00:02:00 72 °C






3m 15s
Pool the 2 PCR replicates together in a.
Transfer2 µL of DNA from the pool plate to a new PCR plate.

Add 2 µL of each barcoding primer to the DNA :
- Nxt_i5_barcoding
- Nxt_i7_barcoding

Prepare a PCR master mix with :

AB
Molecular grade water2098 µl
PCR mix 2X2760 µl

Add 44 µL of the PCR master mix to each well of the plate.

Incubate in a thermocycler with the following protocol :
  • 00:00:30 at 98 °C
  • 00:00:15 at 98 °C
  • 00:01:00 at 72 °C (no anneal step)
  • Repeat from step 2 for 7 cycles
  • 00:02:00 at 72 °C






3m 45s
Pool together 5 µL of each sample.

Purify with SPRI beads using a 0.8 ratio. Resuspend with50 µL of molecular grade water.

Proceed with QC and sequencing.