Jun 24, 2025
Version 1
Homemade Tn5 transposome assembly and activity evaluation V.1
- 1GMU-GIBH Joint School of Life Sciences, The Guangdong-Hong Kong-Macao Joint Laboratory for Cell Fate Regulation and Diseases,Guangzhou Medical University
- NGSTech. support email: [email protected]
Protocol Citation: Wei Xu 2025. Homemade Tn5 transposome assembly and activity evaluation. protocols.io https://dx.doi.org/10.17504/protocols.io.n2bvj69z5lk5/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: April 01, 2022
Last Modified: June 24, 2025
Protocol Integer ID: 60215
Keywords: activity evaluation tn5 transposome assembly, homemade tn5 transposome assembly
Abstract
Tn5 Transposome Assembly and Activity Assessment.
Guidelines
This protocol is suitable for the assembly of purified Tn5 protein with a concentration between 0.5~1 μg/μl.
Materials
| A | B | C | |
| Reagent | Source | Cat.No. | |
| BSA protein standards | Abcam | ab270701 | |
| 2% (wt/vol) digitonin | Promega | G9441 | |
| DNA Clean and Concentrator-5 kit | zymo | Cat#D4014 | |
| SYBR Green | Thermo | S7563 | |
| NEBNext® High-Fidelity 2X PCR Master Mix | NEB | M0541L | |
Before start
This protocol is basically for homemade Tn5 assembly and activity evaluation in ISSAAC-seq. Tn5 activity is determined by bulk ATAC-seq experiments, which mimics the in situ tagmentation condition in ISSAAC-seq experiments.
Unloaded Tn5 is available from vendors such as Diagenode (C01070010-10) or Lucigen (Cat. No. TNP92110). We obtain Tn5 from a local vendor, supplied at approximately 0.5 μg/μl. Also, there are many standard protocols for Tn5 purification, and you can produce your own Tn5 protein if needed. Here are some references for Tn5 purification:
2) Picelli, Simone, et al. "Tn5 transposase and tagmentation procedures for massively scaled sequencing projects." Genome research 24.12 (2014): 2033-2040.
3) Soroczynski,J., et al., OpenTn5 Project: Open-source resource for robust and scalable Tn5 transposase purification and characterization. Molecular Biology of the Cell, 2023. 34(2): p. 1026-1026.
Tn5 protein concentration determination by Western blot.
1d
The concentration and purity of in-house purified Tn5 protein could be further confirmed by Western blot before you start assembly. Tn5 protein is about 53 kDa, and its target band is between 55 kDa and 70 kDa markers on the gel.
Prepare BSA protein concentration standards: dilute 3 µL of 2 mg/ml BSA standard with 21 µL of water to a final concentration of 0.25 mg/ml.
Prepare BSA standards for WB：
| A | B | C | D | E | |
| Standard No. | 0.25 mg/ml BSA (μl) | Water (μl) | 5x loading (μl) | Amount (μg） | |
| 1 | 1 | 15 | 4 | 0.25 | |
| 2 | 2 | 14 | 4 | 0.50 | |
| 3 | 4 | 12 | 4 | 1.00 | |
| 4 | 6 | 10 | 4 | 1.50 | |
| 5 | 8 | 8 | 4 | 2.00 |
Incubate at 95 °C for00:05:00 , centrifuge briefly /.
5m
For each batch, mix 2 µL Tn5, 4 µL 5x loading buffer, and14 µL water. Incubate at 95 °C for00:05:00 , centrifuge briefly /.
5m
Load the samples on a SDS-PAGE gel. After electrophoresis, the protein was transferred to NC membrane and stained with Ponceau S. Compare Tn5 with BSA standards to determine protein concentration.
Expected result 1
Expected result
Tn5 concentration detremination by WB. ( Sample T1-T4 are four different batches of purified Tn5 protein.The concentrations of samples T1 to T4 are all between 0.5-0.75 μg/μl, and can be used for the next step of assembly. Sample T4 has a relatively high concentration.Therefore, assembled T4-Tn5 may require a reduced amount to achieve similar cleavage efficiency compared to other groups.)
Expected result 2
Expected result
Tn5 concentration detremination by WB. (1024 and 0617 are two different batches of purified Tn5. The concentration of batch1024 is about 0.5 μg/μl, and can be used for the next step of assembly. Batch 0607's concentration is about 0.25 μg/μl, which is not suitable for this protocol and needs to be further concentrated.)
Reagent Setup
30m
Reagent Setup
Prepare Annealing Buffer:
| A | B | C | D | |
| Component | Stock concentration | Final concentration | For 1 ml | |
| Tris-HCl, pH=8.0 | 1 M | 10 mM | 10 μl | |
| NaCl | 5 M | 50 mM | 10 μl | |
| EDTA, pH=8.0 | 0.5 M | 1 mM | 2 μl | |
| Nuclease-free water | -- | -- | 978 μl |
Store at -20 °C for up to 6 months.
Prepare Coupling Buffer:
| A | B | C | D | |
| Component | Stock concentration | Final concentration | For 1 ml | |
| Tris-HCl, pH=7.5 | 1 M | 50 mM | 50 μl | |
| NaCl | 5 M | 100 mM | 20 μl | |
| EDTA, pH=8.0 | 0.5 M | 0.1 mM | 0.2 μl | |
| Triton X-100 | 10% | 0.1% | 10 μl | |
| DTT | 1 M | 1 mM | 1 μl | |
| Glycerol | 100% | 50% | 500 μl | |
| Nuclease-free water | - | - | 412 μl |
Store at -20 °C for up to 6 months.
Prepare oligonucleotides：
| A | B | C | |
| #name | seq (5'-3') | Purification | |
| ME_S5 | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG | HPLC | |
| ME_S7 | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG | HPLC | |
| ME_bottom | Phos-C*T*G*T*C*T*C*T*T*A*T*A*C*A*C*A*T*C*/iInvdT/ | HPLC | |
| N7 primer | CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGG | HAP | |
| S5 primer | AATGATACGGCGACCACCGAGATCTACACCTCTCTATTCGTCGGCAGCGTC | HAP |
Dissolve the oligos in annealing buffer from above, to a final concentration of 100 μM. Store at -20 °C for up to 6 months.
Prepare 4x THS TD Buffer:
| A | B | C | |
| Reagent | Final concentration | For 1 ml | |
| 1 M Tris-HCl (pH 8.0) | 132 mM | 132 μl | |
| 5 M potassium acetate | 264 mM | 52.8 µl | |
| 1 M Magnesium acetate | 40 mM | 40 µl | |
| N,N-dimethylformamide | 64% | 640 µl | |
| Nuclease-free water | - | 135.2 µl |
Prepare 0.1% (wt/vol) digitonin: Mix 0.5 µL 2% (wt/vol) digitonin stock with 9.5 µL nuclease-free water.
CRITICAL Make fresh. The Promega 2% (wt/vol) digitonin stock is dissolved in DMSO. Thaw at RT prior to use.
Tn5 transposome Assembly
1h 3m
Adapter annealing.
Mix 25 µL ME_S5 oligo (100 μM) with25 µL ME_Bottom oligo (100 μM) in a PCR tube, and label as "S5_adapter".
Mix 25 µL ME_S7 oligo (100 μM) with 25 µL ME_Bottom oligo (100 μM) in a PCR tube, and label as "S7_adapter".
Anneal adaptor oligo mixtures in a Thermocycler with the following reaction:
- 98 °C 00:03:00
- slowly cooled to 16 °C with a temperature ramp of −0.1 °C/s.
- 16 °C hold.
3m
Dilute the S5_adaptor (50 micromolar (µM) ) and S7_adaptor(50 micromolar (µM) ) with nuclease-free water to(20 micromolar (µM) ). Continue to Step 8 or store at -20 °C for up to 6 months.
Assemble the Tn5 enzyme and annealed oligos:
| A | B | |
| Component | Amount (μl) | |
| Tn5 | 48 | |
| Annealed S5_adapter (20 μM） | 12 | |
| Annealed S7_adapter (20 μM) | 12 | |
| Coupling buffer | 69 | |
| Total | 141 |
Incubate at room temperature for 01:00:00 . Store at -20 °C for up to 1 year.
1h
Tn5 activity evaluation
1d
Perform a fast ATAC-seq experiment to determine the activity of assembled Tn5.
Pellet 50,000 cells for each sample (#1 illumina Tn5，#2 Tn5_batch1, #3 Tn5_batch2…）at 1,000g, 4 °C for 3 min in a fixed-angle centrifuge.
Aspirate and discard all supernatants, resuspend cell pellets in 1 mL ice-cold 1× DPBS–0.5% (wt/vol) BSA and centrifuge at 1,000g, 4 °C for 3 min.
Aspirate all supernatants using a P1000 pipette, and briefly centrifuge again to collect leftover buffer from the bottom of the tube. Remove traces of the buffer using a P200 pipette with a 10 μL tip fitted on top of a 200 μL tip.
Prepare 50 µL tagmentation mix for each sample by combining and mixing the reagents listed in the table below:
| A | B | C | |
| Reagent | Amount (µL) | Final concentration | |
| 4× THS TD buffer | 12.5 | 1× | |
| 0.1% (wt/vol) Digitonin | 5 | 0.01% (wt/vol) | |
| Tn5 | 2.5 | - | |
| Nuclease-free water | 30 | - | |
| Total | 50 | - |
Resuspend the cell pellet in 50 µL tagmentation mix by pipetting up and down 25 times.
Put the 50 µL reaction on a thermomixer, and incubate at 37 °C, 800 rpm for 30 min.
Cleanup reaction with a Zymo DNA Clean and Concentrator-5 kit, elute DNA in 21 μL of elution buffer.
Set up the following PCR reaction:
| A | B | |
| Reagent | Amount (µL) | |
| Purified sample | 8 | |
| N7 primer (10 µM) | 1 | |
| S5 primer (10 µM) | 1 | |
| NEBNext High-Fidelity 2× PCR Master Mix | 10 | |
| Total | 20 |
Take out 9 µL of each reaction, and mix with1 µL 10X SYBR Green and perform a qPCR analysis to decide the cycle number.
Use the following cycling condition to perform a qPCR analysis, and monitor the amplification curve in linear scale.
| A | B | C | D | |
| Steps | Temperature(℃) | Time | Cycles | |
| Gap fill-in | 72 | 5 min | 1 | |
| Initial Denaturation | 98 | 1 min | 1 | |
| Denaturation | 98 | 10 s | 30 | |
| Annealing | 63 | 30 s | ||
| Extension | 72 | 20 s |
Expected result
Amplification Plot of qPCR. The Ct values of Tn5_lot1024 are comparable to illumina_Tn5, thus can be used in subsequent experiments.
Expected result
Amplification Plot of qPCR. The Ct value of lot0607 was significantly different from that of the illumina control, indicating that the purification may fail, and this batch of Tn5 cannot be used in subsequent experiments.
Validation of ATAC-seq library fragment length distribution.
Amplify the rest 11 μL PCR reaction for 12 cycles, purify the PCR product using 1.2x VAHTS DNA Clean Beads, elute in 20 μL water and check the size distribution using a bioanalyzer.
Expected result
Distribution of ATAC-seq libraries. (Successful experiments with a prominent nucleosomal ladder pattern.)