Aug 02, 2024
  • 1UGent
Icon indicating open access to content
QR code linking to this content
Protocol CitationLaurens Lambrechts, Sofie De Braekeleer, Basiel Cole, Linos Vandekerckhove 2024. HIV-PULSE Wet-lab Protocol. protocols.io https://dx.doi.org/10.17504/protocols.io.8epv5rby4g1b/v2Version created by Laurens Lambrechts
Manuscript citation:
Laurens Lambrechts, Noah Bonine, Rita Verstraeten, Marion Pardons, Ytse Noppe, Sofie Rutsaert, Filip Van Nieuwerburgh, Wim Van Criekinge, Basiel Cole, Linos Vandekerckhove, HIV-PULSE: a long-read sequencing assay for high-throughput near full-length HIV-1 proviral genome characterization, Nucleic Acids Research, Volume 51, Issue 20, 10 November 2023, Page e102, https://doi.org/10.1093/nar/gkad790
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: August 02, 2024
Last Modified: August 02, 2024
Protocol  Integer ID: 104466
Keywords: nanopore, hiv, umi, hiv, pulse wet, updated protocol, pulse, assay, protocol
Abstract
Protocols.io for HIV-PULSE assay, including an updated protocol from the work published in NAR.
Materials
Qubit dsDNA HS Assay Kit (Q32854)
Quant-iT PicoGreen dsDNA Assay Kit (P7589)
CleanPCR beads (CPCR-0050) 
Custom size select CleanPCR beads  
LongAmp Hot Start Taq DNA Polymerase (M0534L)
dNTPs (Promega, C1141)
PrimeSTAR GXL DNA Polymerase (R050A)
GeneRuler 1 kb Plus DNA Ladder, ready to use (SM1333)
GeneRuler 1 kb DNA Ladder (SM0311)
Native Barcoding Kit 24 V14 kit (ONT, SQK-NBD114-24)
MinION R10.4.1 flow cells (ONT, FLO-MIN114)

Primers (IDT)
ABCD
PCR-step Assay Name Sequence (5’ to 3’) 
Pre-amplification Pinzone outer Pinzone First PCR Fwd CCTCAATAAAGCTTGCCTTGAGTGC 
Pinzone First PCR Rev CCTAGTTAGCCAGAGAGCTCCCAG 
FLIPS/Lee outer BLOuterF; U5-623F AAATCTCTAGCAGTGGCGCCCGAACAG 
BLOuterR; U5-601R TGAGGGATCTCTAGTTACCAGAGTC 
Tagging (PAGE purified)Pinzone inner UMI_Pinzone_F2 CAAGCAGAAGACGGCATACGAGATNNNYRNNNYRNNNYRNNNAAGTAGTGTGTGCCCGTCTGTTGTGTGAC 
UMI_Pinzone_R2 AATGATACGGCGACCACCGAGATCNNNYRNNNYRNNNYRNNNGGAAAGTCCCCAGCGGAAAGTCCCTTGTAG 
Lee inner UMI_Lee_F2 CAAGCAGAAGACGGCATACGAGATNNNYRNNNYRNNNYRNNNGCGCCCGAACAGGGACYTGAAARCGAAAG 
UMI_Lee_R2 AATGATACGGCGACCACCGAGATCNNNYRNNNYRNNNYRNNNGCACTCAAGGCAAGCTTTATTGAGGCTTA 
Amplification (PCR1 to PCR3) PCR1 to 3 ncec_pcr_fw_v7 CAAGCAGAAGACGGCATACGAGAT 
ncec_pcr_rv_v7 AATGATACGGCGACCACCGAGATC 
Patient barcoding (PCR4) ID1 ONT_fw1 ACGAGACTGATTCAAGCAGAAGACGGCATACGAGAT 
ONT_UD1_R ACGAGACTGATTAATGATACGGCGACCACCGAGATC 
ID2 ONT_fw2 GCTGTACGGATTCAAGCAGAAGACGGCATACGAGAT 
ONT_UD2_R GCTGTACGGATTAATGATACGGCGACCACCGAGATC 
ID3 ONT_fw3 ATCACCAGGTGTCAAGCAGAAGACGGCATACGAGAT 
ONT_UD3_R ATCACCAGGTGTAATGATACGGCGACCACCGAGATC 
ID4 ONT_fw4 TGGTCAACGATACAAGCAGAAGACGGCATACGAGAT 
ONT_UD4_R TGGTCAACGATAAATGATACGGCGACCACCGAGATC 
ID5 ONT_fw5 ATCGCACAGTAACAAGCAGAAGACGGCATACGAGAT 
ONT_UD5_R ATCGCACAGTAAAATGATACGGCGACCACCGAGATC 
ID6 ONT_fw6 GTCGTGTAGCCTCAAGCAGAAGACGGCATACGAGAT 
ONT_UD6_R GTCGTGTAGCCTAATGATACGGCGACCACCGAGATC 
ID7 ONT_fw7 AGCGGAGGTTAGCAAGCAGAAGACGGCATACGAGAT 
ONT_UD7_R AGCGGAGGTTAGAATGATACGGCGACCACCGAGATC 
ID8 ONT_fw8 ATCCTTTGGTTCCAAGCAGAAGACGGCATACGAGAT 
ONT_UD8_R ATCCTTTGGTTCAATGATACGGCGACCACCGAGATC 
Before start
The HIV-PULSE assay consists of six different PCR steps followed by sequencing on the Minion long read sequencer from Oxford Nanopore Technologies. The main steps are as follows; (i) pre-amplification (to increase sensitivity) and tagging of pre-amplified HIV-1 fragments at each end with a unique UMI, (ii) PCR amplification (split over multiple PCR rounds) will amplify all UMI tagged amplicons making use of the universal synthetic primers attached to each UMI end, (iii) sequencing will be performed on long read sequencer so reads will span the entire HIV-1 fragment with the attached UMI fragments at both ends needed for the bio-informatic workflow (https://github.com/laulambr/longread_umi_hiv). 
Pre-amplification: PCR using PrimeSTAR GXL
Calculate the x µL volume of sample needed to have an input of 500 ng of genomic DNA.

More important than the 500 ng is the actual HIV-1 input copies. Minimum 30 copies based on total HIV-1 measurements is advised to obtain at least a single genome.

Prepare the master mix according to this principle (if doing replicates, add DNA to master mix, mix well and then divide per sample to ensure ‘even’ input), beware to adapt the mix according to the required DNA input volume: 
a. x µL DNA input 
b. 33- x µL NFW 
 Stock conc. Final conc. Quantity per rx (µL) 
DNA   
5X PrimeSTAR GXL Buffer 5X 1X 10 
dNTP Mixture (PS GXL) 2,5 mM 200 µM each 
Pinzone First PCR F 10 µM 0,2 µM 
Pinzone First PCR R 10 µM 0,2 µM 
PrimeSTAR GXL DNA Polymerase 1.25 U/µL 1,25 U / 50 µl 
Nuclease free water 32 
Total   50 
Use the following PCR cycling conditions on the cycler. The number of cycles can vary depending on the HIV-1 copy number of the input sample, most important requirement is generating enough yield in order to sequence. Some guidelines: 
a. > 2500 total HIV-1 copies/million CD4 T cells: 5 pre-amp cycles 
b. < 2500 total HIV-1 copies/million CD4 T cells: 6 pre-amp cycles 
ABC
STEP TEMP TIME 
Initial Denaturation 98°C 2 minutes 
x Cycles 98°C 10 seconds 
65°C (Pinzone) 15 seconds 
68°C 10 minutes 
Final Extension 68°C 10 minutes 
Hold 4-10°C  
Pre-amplification: cleanup
Cleanup of the PCR product using the original CleanPCR beads (CleanNA) at 1.0x ratio. Thus for 50 µL reaction volume of PCR 1, add 50 µL µL of CleanPCR beads.
Make sure the CleanPCR magnetic beads are at room temperature.
Prepare a fresh 70% Ethanol solution.
Vortex the bead solution for00:00:30 to homogenize the beads.

30s
Add50 µL of bead solution to 50 µL of PCR 1 product and mix by flicking. If you have multiple samples, change tip!
Incubate for 00:05:00 at room temperature.

5m
Spin down in mini centrifuge.
Place the sample on a magnet for 00:02:00 or until the supernatant has cleared.

2m
Keep sample on magnet, discard supernatant without disturbing the bead pellet. If you have multiple samples, change tip!
Wash the beads with fresh 70% Ethanol by adding 400 µL at the opposite side of the beads (if recipient doesn’t hold 400 µL , adapt volume and just make sure that beads are covered in ethanol). Do not resuspend the beads!
Incubate for00:00:30 and remove the ethanol.

30s
Repeat the washing steps 13 & 14.
Remove excess ethanol by using a P20 pipet (optionally you can also spin down the sample and put back on magnet.
Let the beads air dry for 00:00:30 or until the pellet loses its shine (but avoid cracking of DNA since this will make resuspending hard).

30s
Remove sample from magnet.
Elute the purified DNA by adding 35 µL NFW. Mix by flicking the tube.

Incubate for 00:05:00 at room temperature.

5m
Put sample on magnet for00:02:00 or until the supernatant has cleared.

2m
Transfer30 µL of cleaned DNA to new tube.

Tagging: PCR
Prepare master mix for PCR2 (can be done during pre-amplification PCR). Use the 30 µL of cleaned DNA from previous step as input. 
 Stock conc. Final conc. Quantity per rx (µL) 
cleaned PCR 1 supernatant    30 
5X LongAmp Taq Reaction Buffer 5x 1x 10 
dNTP mix 10 mM 100 µM 1.5 
Inner UMI HIV PCR Fwd 10 µM 500 nM 2.5 
Inner UMI HIV PCR Rev 10 µM 500 nM 2.5 
LongAmp Taq DNA Polymerase 5U/µL 0.5U 
Nuclease free water 1.5 
   50 

Use the inner HIV primers with a UMI tail and not the regular ones. Primers with UMI should be PAGE purified.
Use the following PCR cycling conditions on the cycler.  
ABC
STEP TEMP TIME 
Initial Denaturation 94°C 1m 15 seconds 
2 Cycles 94°C 30 seconds 
58 °C 30 seconds 
65°C 10 minutes 
Final Extension 65°C 10 minutes 
Hold 4-10°C  

34m
Do not change the number of cycles since this would mess up the tagging!
Tagging: cleanup
Make sure the custom CleanPCR magnetic beads are at room temperature.
Cleanup of the PCR product using the custom CleanPCR beads at a defined ratio for that custom batch.
Prepare a fresh 70% Ethanol solution.
Vortex the custom bead solution for 00:00:30 to homogenize the beads.

30s
Add 50*ratio µL of bead solution to 50 µL of PCR 2 product and mix by flicking. If you have multiple samples, change tip!

Perform clean up as listed in steps 9 to 18.
Elute the purified DNA by adding 35 µL Mix by flicking the tube.

Incubate for 00:05:00 at room temperature.

5m
Put sample on magnet for 00:02:00 or until the supernatant has cleared.

2m
Transfer 30 µL of supernatant to new tube.

PCR round 1-2-3: amplification of UMI tagged amplicons
Prepare master mix for amplification PCR 1 or PCR 2/3 (Mix is different, for PCR1 30 µL input, while in PCR 2-3 10 µL ).
a. For PCR 1: use the30 µL of cleaned tagged DNA from tagging step as input.
b. For PCR2-3: use the 10 µL of cleaned DNA from previous step as input. Store the remaining 20 µL at-20 °C .

Component Stock conc. Final conc. Quantity (µL) 
Eluted UMI tagged DNA   30 
5X LongAmp Taq Reaction Buffer 10x 1x 10 
dNTP mix 10 mM 200 µM 1.5 
Forward_PCR_ONT 10 µM 500 nM 2.5 
Reverse_PCR_ONT 10 µM 500 nM 2.5 
LongAmp Taq DNA Polymerase 5U/µL 1.25U 
Nuclease free water 1.5 
Total   50 
PCR mix for PCR 1 
Component Stock conc. Final conc. Quantity (µL) 
Eluted UMI tagged DNA   30 
5X LongAmp Taq Reaction Buffer 10x 1x 10 
dNTP mix 10 mM 200 µM 1.5 
Forward_PCR_ONT 10 µM 500 nM 2.5 
Reverse_PCR_ONT 10 µM 500 nM 2.5 
LongAmp Taq DNA Polymerase 5U/µL 1.25U 
Nuclease free water 1.5 
Total   50 
PCR mix for PCR 2-3 
Use the following PCR cycling conditions on the cycler. 
ABC
STEP TEMP TIME 
Initial Denaturation 94°C 1m 15 seconds 
10 Cycles 94°C 30 seconds 
60 °C 30 seconds 
65°C 10 minutes 
Final Extension 65°C 10 minutes 
Hold 4-10°C  
PCR round 1-2-3: cleanup
Make sure the regular CleanPCR magnetic beads are at room temperature.
Prepare a fresh 70% Ethanol solution.
Vortex the custom bead solution for 00:00:30 to homogenize the beads.

30s
Use the original CleanPCR beads (CleanNA) at 1.0x ratio. Thus for 50 µL reaction volume of PCR product, add 50 µL of CleanPCR beads. Mix by flicking. If you have multiple samples, change tip!

Perform clean up as listed in steps 9 to 18.
Elute the purified DNA by adding 35 µL NFW. Mix by flicking the tube.

Incubate for 00:05:00 t room temperature.

5m
Put sample on magnet for 00:02:00 or until the supernatant has cleared.

2m
Transfer 30 µL of supernatant to new tube.

PCR round 4: amplification of UMI tagged amplicons with sample specific primers
For the last PCR round, we will tag replicates from the same sample with the same primerset tailed with an index (ID1-8). This will allow later for demultiplexing the replicates per sample based on this index.  
Component Stock conc. Final conc. Quantity (µL) 
Eluted UMI tagged DNA   20 
5X LongAmp Taq Reaction Buffer 10x 1x 10 
dNTP mix 10 mM 200 µM 1.5 
Forward_PCR_ONT 10 µM 500 nM 2.5 
Reverse_PCR_ONT 10 µM 500 nM 2.5 
LongAmp Taq DNA Polymerase 5U/µL 1.25U 
Cresol red 10x 1x 
Nuclease free water 6.5 
Total   50 
PCR mix for PCR 4
Prepare master mix for amplification PCR 4. Note that this also uses cresol red and more cleaned material as input to ensure enough yield.
Use the following PCR program.
ABC
STEP TEMP TIME 
Initial Denaturation 94°C 1m 15 seconds 
10 Cycles 94°C 30 seconds 
61°C 30 seconds 
65°C 10 minutes 
Final Extension 65°C 10 minutes 
Hold 4-10°C  
PCR program is slightly adapted from other PCR programs to compensate for longer tailed primers and reduce primer/dimer. 
PCR round 4: gel
After PCR is finished, transfer 5 µL and visualize on a 1% agarose gel (00:30:00 , 120 Volt) with a GeneRuler 1 kb Plus DNA Ladder (SM1333) for reference. When imaging, use the faint settings. 

30m
PCR round 4: cleanup, concentration measurement and pooling
Make sure the custom CleanPCR magnetic beads are at room temperature.
Cleanup of the PCR product using the custom CleanPCR beads at a defined ratio for that custom batch.
Prepare a fresh 70% Ethanol solution.
Vortex the custom bead solution for 00:00:30 to homogenize the beads.

30s
Add 45*ratio µL of bead solution to 45 µL of PCR 4 product and mix by flicking. If you have multiple samples, change tip!

Perform clean up as listed in steps 9 to 18.
Elute the purified DNA by adding 18 µL NFW. Mix by flicking the tube.

Incubate for 00:05:00 at room temperature.

5m
Put sample on magnet for00:02:00 or until the supernatant has cleared.

2m
Transfer 15 µL of supernatant to new tube.

Quantify with Picogreen, by taking1 µL of cleaned product as input (performed in duplicate).

Based on measured DNA concentrations and estimated overall fragment length (~4-6 kb), calculate for each replicate the equimolar sample pooling strategy.
Sequencing
For sequencing protocol, see ONT protocols. Use LFB. Each replicate will be run with a different native barcode from the nanopore barcoding kits (NB01-24). If reusing a flowcell, try to avoid including a barcode already used in previous run. 
Extra: make CUSTOM SPRI bead solution
30s
Protocol based on 'SPRI size selection protocol for > 1.5-2 kb DNA fragments' from Oxford Nanopore Technologies.

Step 1: Prepare the custom buffer by mixing: 

Final Stock Input (µL) 
10 mM Tris-HCl 1 M 20 
1 mM EDTA pH 8 0.5 M 
1.6 M NaCl 5 M 640 
11% PEG 8000 50% (w/v) 440 
Nuclease free water 888 
Total  1992 

Step 2: Transfer bead to Custom buffer 

Bring CleanPCR beads (CleanNA) to room temperature.
Vortex for00:00:30 to resuspend beads properly.

30s
Transfer beads into two 1.5 mL tubes so each contains 1 mL .

Place the tubes on the magnet, wait until the solution is clear and discard the supernatant.

Remove the tubes from the magnet, wash with 1 mL of NFW by resuspending the pellet.

Return the tubes to the magnet, allow beads to pellet and pipette of the supernanant.
Repeat this NFW wash once more.
Spin down and place tubes back on magnet. Pipette off any residual water.
Pool the two bead pellets together by resuspending them in200 µL of Custom buffer.

Transfer the beads into the remaining Custom buffer. 

Step 3: Test different ratios of new batch of Custom buffer on DNA ladder to determine perfect ratio.
We generally test a range of different ratios including 0.8x, 0.9x, 1.0x, 1.1x and 1.2x conditions.
new 0.8
new 0.9
new 1.0
new 1.1
new 1.2
 

For each ratio to be tested, take 3 µL of GeneRuler 1 kb DNA Ladder (SM0311), add to 17 µL of TE.

Add to this the required volume of custom buffer (for 1.0x add for instance 20 µL ).

Incubate for00:05:00 at room temperature.

5m
Put on magnet for two minutes or until supernatant has cleared.
Discard supernatant.
Wash by adding 200 µL 70% ethanol, leave 00:00:30 and remove.

30s
Repeat ethanol step once more.
Remove residual ethanol.
Add30 µL NFW buffer.

Take from magnet and resuspend, incubate for 00:05:00

5m
Put on magnet for 00:02:00 until supernatant has cleared.

2m
Remove 30 µL cleaned ladder and put on visualize on a 1% agarose gel.