HIV-1 NC-POL amplification and Oxford Nanopore sequencing for drug resistance analysis

Nicola Coetzee; Kayla Delaney; Marije Hofstra; Urvi Parikh; Kerri Penrose; Cheryl Baxter; Tulio de Oliveira; Gert van Zyl

May 14, 2026

HIV-1 NC-POL amplification and Oxford Nanopore sequencing for drug resistance analysis

DOI

https://dx.doi.org/10.17504/protocols.io.14egn5qdpg5d/v1

Nicola Coetzee¹,
Kayla Delaney¹,
Marije Hofstra²,
Urvi Parikh³,
Kerri Penrose³,
Cheryl Baxter^1,2,
Tulio de Oliveira^2,4,
Gert van Zyl¹

¹Division of Medical Virology, Stellenbosch University;
²Centre for Epidemic Response and Innovation, Stellenbosch University;
³Division of Infectious Diseases, University of Pittsburgh School of Medicine;
⁴KwaZulu-Natal Research Innovation and Sequencing Platform, University of KwaZulu-Natal

Nicola Coetzee

Stellenbosch University

DOI: https://dx.doi.org/10.17504/protocols.io.14egn5qdpg5d/v1

Protocol Citation: Nicola Coetzee, Kayla Delaney, Marije Hofstra, Urvi Parikh, Kerri Penrose, Cheryl Baxter, Tulio de Oliveira, Gert van Zyl 2026. HIV-1 NC-POL amplification and Oxford Nanopore sequencing for drug resistance analysis. protocols.io https://dx.doi.org/10.17504/protocols.io.14egn5qdpg5d/v1

License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited

Protocol status: Working

We use this protocol and it's working

Created: April 23, 2026

Last Modified: May 14, 2026

Protocol Integer ID: 315599

Keywords: drug resistance analysis this protocol, oxford nanopore technology, rna precipitation, oxford nanopore, drug resistance analysis, derived rna, cdna synthesis, polymerase, pcr amplification, nested pcr amplification

Funders Acknowledgements:

Global Health EDCTP3 Joint Undertaking

Grant ID: 101103171

Bill & Melinda Gates Foundation

Grant ID: 101103171

South African Medical Research Council

Grant ID: 96707/23139

Abstract

This protocol describes amplification of the HIV-1 Gag-nucleocapsid and polymerase (NC-POL) region (~3.5 kb) from plasma-derived RNA, followed by Oxford Nanopore Technologies (ONT) sequencing. The workflow includes RNA precipitation, cDNA synthesis, nested PCR amplification, bead-based purification, and sequencing using ONT platform.

Materials

SuperScript™ IV First-Strand Synthesis SystemThermo Fisher ScientificCatalog #18091050  
Platinum™ SuperFi II PCR Master MixInvitrogen - Thermo FisherCatalog #12368050  
Agencourt RNAClean XP BeadsBeckman CoulterCatalog #A63987  
Agencourt AMPure XP beadsBeckman CoulterCatalog #A63881  Ethanol, Absolute, Molecular Grade, 500MLMerckCatalog #E7023-500ML  
2-PropanolMerck MilliporeSigma (Sigma-Aldrich)Catalog #34863-1L 
Guanidine thiocyanate solutionMerck MilliporeSigma (Sigma-Aldrich)Catalog #50983-50ML  
DTT (dithiothreitol)Thermo FisherCatalog #R0862 
GlycogenMerck MilliporeSigma (Sigma-Aldrich)Catalog #10901393001  
N-Lauroylsarcosine sodium saltMerck MilliporeSigma (Sigma-Aldrich)Catalog #L9150  
Sodium CitrateMerck MilliporeSigma (Sigma-Aldrich)Catalog #71402   
UltraPure DNase/RNase-Free Distilled WaterThermo Fisher ScientificCatalog #10977023  
twin.tec 96-well DNA LoBind PlatesEppendorfCatalog #0030129504  
DNA LoBind 1.5 mL tubesEppendorfCatalog #EP0030108418  
Qubit® dsDNA HS Assay kitThermo Fisher ScientificCatalog #Q32854  
Microseal B Film, AdhesiveBioRadCatalog #MSB1001B 
Microseal F Foil, AdhesiveBioRadCatalog #MSF1001B  
Native Barcoding Kit 96 V14Oxford Nanopore TechnologiesCatalog #SQK-NBD114.96  
Flongle Flow CellOxford Nanopore TechnologiesCatalog #FLO-FLG114  
MinION Flow CellOxford Nanopore TechnologiesCatalog #FLO-MIN114  
Trizma® Hydrochloride SolutionMerck MilliporeSigma (Sigma-Aldrich)Catalog #T2694-100ML  
P10, P20, P200 and P1000 Filter TipsNEST Biotechnology  
5 mL Fine-Tip Pasteur PipetteDelta LaboCatalog #027-210022  
1.5 mL Microcentrifuge TubesNEST Biotechnology  
0.2 mL 8-Strip PCR TubesLasecCatalog #P2TUB054C-000.28  
96-well Semi-skirted PCR PlatesNEST BiotechnologyCatalog #402301  


PrimerDirectionSequence (5'-3')Position (HXB2)
F1aForwardGGG AAG TGA YAT AGC WGG AAC1488–1505
F1bForwardGTG AYA TAG CWG GAA CTA CTA G1493–1511
R1aReverseTAG TGG GAT GTG TAC TTC TGA AC5195–5213
R1bReverseTAG TGG GAT GTG TAC TTC TGA5197–5214
F_2aForwardCCTTCAGGAACAAATAGCATGGA1515–1537
F_2bForwardTCAGGAACAAATAGCATGGATGAC1518–1541
R2aReverseTCAGGAACAAATAGCATGGATGAC5164–5188
R2bReverseATGGTGCTTTACTARACTRTTCCATG5099–5124
Primers for NC-POL amplification

Troubleshooting

Problem

No PCR product

Solution

Check RNA concentration after extraction, increase input. Use alternative validated primer sets targeting same region

Problem

Smearing on gel

Solution

Dilute cDNA

Problem

Poor sequencing coverage

Solution

Increase input or reduce library size

Before start

Make up Viral Lysis Buffer (12 mL):
2 mL of 6 M GUSCN
56 mL of 1 M DTT 
4 mL of Glycogen (20 mg/mL)
12 g of N-Lauroylsarcosine salt
12 g of Sodium citrate
64 mL of DNase/RNase-Free Distilled Water

RNA precipitation

3h 17m

This section describes ethanol precipitation and purification of viral RNA from plasma.

Add 0.5-1 mL   plasma to a 1.5 mL microcentrifuge tube.

Centrifuge at 2700 x g, 4°C  for 00:15:00  .

15m

Transfer supernatant to a new microcentrifuge tube.

Centrifuge at 24000 x g, 10°C  for 01:00:00  .

Remove and discard supernatant using a fine-tip pasteur pipette.

Add 600 µL   of Viral Lysis Buffer.

Vortex briefly and spin down tubes. DO NOT VIGOROUSLY VORTEX.

Incubate atRoom temperature   for 00:10:00  .

10m

Add 600 µL   of 100% Isopropanol and mix by inversion (30 times).

Centrifuge at 21100 x g, 10°C  for 00:20:00  .

20m

Wash the pellet 3× with 1000 µL   of 70% EtOH. 
Centrifuge at 21100 x g, 10°C  for 00:20:00   during the first two washes and 00:10:00  during the final wash.

Briefly centrifuge and remove any remaining EtOH using a P10 pipette. 

Air dry for 00:15:00  .

15m

Resuspend RNA pellet in ice cold 5 millimolar (mM)   Tris-HCl according to the pre-determined plasma viral load:

HIV-RNA plasma viral load (copies/mL)Volume of 5mM Tris-HCl (µL)
<50 00020
50 000 - 100 00035
>100 00050
*If viral load is unknown, use 20 µL   resuspension volume.

Incubate without mixing for >00:05:00  .
    

Pipette mix carefully until pellet resuspended.

cDNA synthesis

1h 20m

Prepare the RNA-primer Mix and RT Mix as following:

ReagentFinal concentrationVolume per reactionVolume per reaction
dNTPs10 mM0.5 mM1
Reverse primer set R1a:R1b10 µM (1:1)0.25 µM1
Nuclease-free water--1
Template RNA10
Total volume13
RNA-primer Mix

ReagentFinal concentrationVolume per reactionVolume per reaction
5x SSIV buffer5X1X4
DTT0.1 M0.01 M1
Ribonuclease inhibitor40 U/μL40 U1
Superscript IV Reverse Transcriptase200 U/ μL50 U1
Total volume7
RT Mix
 

15m

Add 3 µL   of antisense mix into each PCR tube.

Add 10 µL   of RNA to RNA-primer mix.

Incubate at 65 °C   for 00:05:00   and immediately cool on ice for at least 00:02:00  .

Add 7 µL   of RT mix to RNA-primer mix.

Incubate at 50 °C   for 00:50:00   and 85 °C  for 00:05:00  .

55m

cDNA cleanup

41m

 This section describes purification of cDNA using RNAClean XP magnetic beads.

Add 20 µL   of cDNA to 1.5 mL microcentrifuge tube.

Add 36 µL   of RNAClean XP beads to reaction volume (1.8× cDNA volume).

Incubate at Room temperature   for 00:10:00  .

10m

Place tubes on a magnetic rack and wait for liquid to clear ~00:05:00  .

Remove and discard supernatant.

Wash beads 3× with 250 µL  of 70% EtOH. 

10m

Briefly centrifuge and remove any remaining EtOH using a P10 pipette without disturbing the bead pellet.

Air dry for ~00:02:00  .

Resuspend beads in 20 µL   5 millimolar (mM)  Tris-HCl.

Briefly centrifuge and incubate on shaker at Room temperature   for 00:05:00  .

Place tubes on a magnetic rack and wait for liquid to clear ~00:02:00  .

Transfer elute to a new microcentrifuge tube.

Pre-nested PCR

2h 51m

Prepare Pre-nested PCR Master Mix as follow:

ReagentFinal concentrationVolume per reactionVolume per reaction
SuperFi II PCR Master Mix2X1X10
Forward primer set: F1a:F1b20 µM (1:1)0.4 µM0.4
Reverse primer set: R1a:R1b20 µM (1:1)0.4 µM0.4
Nuclease-free water4.2
cDNA5
Total volume20
Pre-nested Master Mix

10m

Aliquot 15 µL   of Pre-nested Master Mix into each PCR tube.

Add 5 µL   of purified cDNA to master mix.

Template Adjustment:
HIV-1 plasma viral load <50 000 copies/mL: use undiluted cDNA
HIV-1 plasma viral load ≥50 000 copies/mL: dilute cDNA 1:20

Seal and spin tubes/plate down and run PCR following the conditions below

StepTemperature (°C)DurationCycles
Phase I
Initial denature982 minutes1
Phase II
Denature9810 secondes5
Anneal5815 seconds
Extension723 minutes
Phase III (touchdown)
Denature9810 seconds15
Anneal (Decrease by 0.5°C each cycle5815 seconds
Extension723 minutes
Phase IV
Denature9810 seconds15
Anneal5015 seconds
Extension723 minutes
Phase V
Final extension726 minutes
Thermocycling condition for NC-POL PCR

2h 35m

Nested PCR

4h 17m

Prepare the Nested Master Mix as follow:

 
ReagentStock concentrationFinal concentrationVolume per reaction
SuperFi II PCR Master Mix2X1X10
Forward primer set: F_2a:F_2b20 µM (1:1)0.4 µM0.4
Reverse primer set: R2a:R2b20 µM (1:1)0.4 µM0.4
Nuclease-free water4.2
Pre-nested PCR product5
Total volume20
Nested Master Mix
 

10m

Aliquot 15 µL   of Nested Master Mix into each PCR reaction.

Dilute Pre-nested PCR product 1:50 using 5 millimolar (mM)   Tris-HCl.

Add 5 µL   of diluted Pre-nested product to Nested PCR reaction.

    Run same thermocycling conditions as for the Pre-nested PCR (Step 4.3).

Expected Product: 
Expected result
Confirm amplified product size of ~3.5 kb by agarose gel electrophoresis.

PCR product clean-up

43m

This section describes bead-based purification of PCR products using AMPure XP magnetic beads.

Transfer 16 µL   of Nested PCR product to DNA LoBind tube.

Add 28.8 µL   of AMPure XP beads to reaction volume (1.8× Nested PCR volume after gel electrophoresis).

Incubate on shaking incubator at 900 rpm, Room temperature   for 00:05:00  .

Place on magnetic rack and wait for liquid to clear ~00:02:00   .

Remove and discard supernatant.

Wash beads 2× with 250 µL  of 80% EtOH.

Briefly centrifuge and remove remaining EtOH using a P10 pipette without disturbing the bead pellet.

Air dry for ~00:03:00  .

Resuspend beads in 20 µL   5 millimolar (mM)  Tris-HCl.

Briefly centrifuge and incubate on shaking incubator at 900 rpm, 37°C   for 00:05:00  .

Place tubes on a magnetic rack and wait for liquid to clear ~00:02:00  .

Transfer elute to a new DNA LoBind tube.

Note
Quantification
Measure DNA using Qubit dsDNA HS Assay on a Qubit fluorometer.
Recommended input for sequencing: 200 fmol (455 ng for 3.5 kb amplicon).
DNA concentrations should be used for equimolar pooling prior to sequencing.

15m

Oxford Nanopore Sequencing

3h 10m

Prepare sequencing libraries using the ONT Native Barcoding Kit 96 V14 (SQK-NBD114.96) protocol.

Note
Sequencing library size (≤30 amplicons per Flongle recommended).

Load onto R10.4.1 Flongle (FLO-FLG114) or R10.4.1 flow cell (FLO-MIN114) and run on GridION with the following run parameters:

Standard run time: 24 hours
High accuracy basecalling
Trim barcodes
Size selection: Read length (2.5 kb – 4.5 kb)
Qscore: 9

10m

Data Analysis

This section describes analysis of Oxford Nanopore sequencing data using bioinformatic pipelines and sequence analysis software for consensus sequence generation and HIV drug resistance interpretation.

    Analysis pipeline: Nano-RECall for the POL region and Nano_RECall_NC for the Gag-NC region.

Expected result
Adequate sequencing coverage across POL and NC region (400 X).

Drug resistance interpretation: Stanford University HIV Drug Resistance Database.

Translated NC consensus sequence mutation analysis: Geneious Prime.

Acknowledgements

The GenPath Africa project is funded by the Global Health EDCTP3 Joint Undertaking and its members as well as Bill & Melinda Gates Foundation (101103171) and the South African Medical Research Council (Project ID: 96707/23139).

Primer	Direction	Sequence (5'-3')	Position (HXB2)
F1a	Forward	GGG AAG TGA YAT AGC WGG AAC	1488–1505
F1b	Forward	GTG AYA TAG CWG GAA CTA CTA G	1493–1511
R1a	Reverse	TAG TGG GAT GTG TAC TTC TGA AC	5195–5213
R1b	Reverse	TAG TGG GAT GTG TAC TTC TGA	5197–5214
F_2a	Forward	CCTTCAGGAACAAATAGCATGGA	1515–1537
F_2b	Forward	TCAGGAACAAATAGCATGGATGAC	1518–1541
R2a	Reverse	TCAGGAACAAATAGCATGGATGAC	5164–5188
R2b	Reverse	ATGGTGCTTTACTARACTRTTCCATG	5099–5124

	HIV-RNA plasma viral load (copies/mL)	Volume of 5mM Tris-HCl (µL)
	<50 000	20
	50 000 - 100 000	35
	>100 000	50

Reagent	Final concentration	Volume per reaction	Volume per reaction
dNTPs	10 mM	0.5 mM	1
Reverse primer set R1a:R1b	10 µM (1:1)	0.25 µM	1
Nuclease-free water	-	-	1
Template RNA			10
Total volume			13

Step	Temperature (°C)	Duration	Cycles
Phase I
Initial denature	98	2 minutes	1
Phase II
Denature	98	10 secondes	5
Anneal	58	15 seconds
Extension	72	3 minutes
Phase III (touchdown)
Denature	98	10 seconds	15
Anneal (Decrease by 0.5°C each cycle	58	15 seconds
Extension	72	3 minutes
Phase IV
Denature	98	10 seconds	15
Anneal	50	15 seconds
Extension	72	3 minutes
Phase V
Final extension	72	6 minutes

Reagent	Stock concentration	Final concentration	Volume per reaction
SuperFi II PCR Master Mix	2X	1X	10
Forward primer set: F_2a:F_2b	20 µM (1:1)	0.4 µM	0.4
Reverse primer set: R2a:R2b	20 µM (1:1)	0.4 µM	0.4
Nuclease-free water			4.2
Pre-nested PCR product			5
Total volume			20