Sep 18, 2023

hissPCR: A simple, single-tube overlapping amplicon-targeted Illumina sequencing assay. V.1

hissPCR: A simple, single-tube overlapping amplicon-targeted Illumina sequencing assay.
  • 1University of California, San Francisco
Icon indicating open access to content
QR code linking to this content
Protocol CitationJason D Limberis, Alina Nalyvayko, Joel Ernst, john.metcalfe 2023. hissPCR: A simple, single-tube overlapping amplicon-targeted Illumina sequencing assay.. protocols.io https://dx.doi.org/10.17504/protocols.io.q26g7yw79gwz/v1Version created by Jason D Limberis
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: March 24, 2023
Last Modified: September 18, 2023
Protocol Integer ID: 79422
Keywords: sequencing assay, sequencing pcr, targeted amplicon, overlapping amplicon, targeted illumina, amplicon, conferring mutation, pathogen, short read limitations of illumina, hisspcr, single tube, splitting of limited clinical sample, mutation, treating infection, limited clinical sample, containing illumina index, illumina
Abstract
Targeted amplicon sequencing to identify pathogens, resistance-conferring mutations, and strain types is an important tool in diagnosing and treating infections. However, due to the short read limitations of Illumina sequencing, many applications require the splitting of limited clinical samples between two reactions. Here, we outline hairpin Illumina single-tube sequencing PCR (hissPCR) which allows for the generation of overlapping amplicons containing Illumina indexes and adapters in a single tube, effectively extending the Illumina read length while maintaining reagent and sample input requirements.
Attachments
Materials

Required
Q5 Hot Start High-Fidelity DNA Polymerase - 500 unitsNew England BiolabsCatalog #M0493L
dNTPs
Agencourt AMPure XPBeckman CoulterCatalog #A63880
PowerUp SYBR Green Master MixCatalog #A25741

A thermocycler and a qPCR machine
A magnetic rack

Primers
ABC
Primer SetDirectionSequence
Rv0678F1ACACTCTTTCCCTACACGACGCTCTTCCGATCTtcgatccgctgtggcttggc
Rv0678F2GACTGGAGTTCAGACGTGTGCTCTTCCGATCTgccgctcgggatcacacacc
Rv0678R1GACTGGAGTTCAGACGTGTGCTCTTCCGATCTttgactcggttggcgggtcg
Rv0678R2ACACTCTTTCCCTACACGACGCTCTTCCGATCTcgacgagcgcctcgttgttg
Illumina adapter primerFAATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCTCTTCCGATCT
Illumina adapter primerRGATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i7]ATCTCGTATGCCGTCTTCTGCTTG
Illumina_quant_InnerFACACTCTTTCCCTACACGACGCTCTTCCGATCT
Illumina_quant_InnerRGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
Illumina_quant_OuterFCAAGCAGAAGACGGCATACGAGAT
Illumina_quant_OuterRAATGATACGGCGACCACCGAGATC
*e.g., [i5] = A501 = TGAACCTT; [i7] = A701 = ATCACGAC
Lowercase bases are gene specific regions, change these if designing your own primer set

Primer design
Primers must be designed as shown in the figure below, if any amplicon is larger than the 2 x sequencing length, the inner portion of the amplicon will not be covered. We have developed a pipeline to assist in creating primers, which is available here: hisPCR primer design, and is used as follows.
hissPCR Primer design strategy
hisPCR_primer_designer.sh \
--name "rpob_demo" \
--seq_cycles 300 \
--start 100 \
--end 800 \
--template "ttgaccgatgaccccggttcaggcttcaccacagtgtggaacgcggtcgtctccgaacttaacggcgaccctaaggttgacgacggacccagcagtgatgctaatctcagcgctccgctgacccctcagcaaagggcttggctcaatctcgtccagccattgaccatcgtcgaggggtttgctctgttatccgtgccgagcagctttgtccaaaacgaaatcgagcgccatctgcgggccccgattaccgacgctctcagccgccgactcggacatcagatccaactcggggtccgcatcgctccgccggcgaccgacgaagccgacgacactaccgtgccgccttccgaaaatcctgctaccacatcgccagacaccacaaccgacaacgacgagattgatgacagcgctgcggcacggggcgataaccagcacagttggccaagttacttcaccgagcgcccgcacaataccgattccgctaccgctggcgtaaccagccttaaccgtcgctacacctttgatacgttcgttatcggcgcctccaaccggttcgcgcacgccgccgccttggcgatcgcagaagcacccgcccgcgcttacaaccccctgttcatctggggcgagtccggtctcggcaagacacacctgctacacgcggcaggcaactatgcccaacggttgttcccgggaatgcgggtcaaatatgtctccaccgaggaattcaccaacgacttcattaactcgctccgcgatgaccgcaaggtcgcattcaaacgcagctaccgcgacgtagacgtgctgttggtcgacgacatccaattcattgaaggcaaagagggtattcaagaggagttcttccacaccttcaacaccttgcacaatgccaacaagcaaatcgtcatctcatctgaccgcccacccaagcagctcgccaccctcgaggaccggctgagaacccgctttgagtgggggctgatcactgacgtacaaccacccgagctggagacccgcatcgccatcttgcgcaagaaagcacagatggaacggctcgcggtccccgacgatgtcctcgaactcatcgccagcagtatcgaacgcaatatccgtgaactcgagggcgcgctgatccgggtcaccgcgttcgcctcattgaacaaaacaccaatcgacaaagcgctggccgagattgtgcttcgcgatctgatcgccgacgccaacaccatgcaaatcagcgcggcgacgatcatggctgccaccgccgaatacttcgacactaccgtcgaagagcttcgcgggcccggcaagacccgagcactggcccagtcacgacagattgcgatgtacctgtgtcgtgagctcaccgatctttcgttgcccaaaatcggccaagcgttcggccgtgatcacacaaccgtcatgtacgcccaacgcaagatcctgtccgagatggccgagcgccgtgaggtctttgatcacgtcaaagaactcaccactcgcatccgtcagcgctccaagcgctag"


Stage 1 PCR

AB
COMPONENTVolume (µl)
5X Q5 Reaction Buffer10
5X Q5 High GC Buffer10
10 mM dNTPs1
Q5 High-Fidelity DNA Polymerase0.5
10µM Forward primer 11
10µM Reverse primer 21
20 mg/ml BSA5
Template DNA (~1ng/ul)5
Nuclease-Free Water18.5
The total volume is 50ul at this stage


ABCD
StepTemp (C)Time (s)Cycles
Denaturation981201
Denaturation981010
Annealing6415
Extension7245
Extension4Forever1
Cycle parameters

As soon as the sample hits 4 °C , proceed to step 2.
Stage 2 PCR
Add the below into the reaction while at 4 °C and proceed to the second PCR cycling
AB
COMPONENTVolume (µl)
10µM Forward primer 20.15
10µM Reverse primer 10.15
10µM Forward Illumina adapter primer0.35
10µM Reverse Illumina adapter primer0.35
The total volume is 51ul at this stage
ABCD
StepTemp (C)Time (s)Cycles
Denaturation98101
Denaturation981020
Annealing6515
Extension7230
Extension721201
Cycle parameters


Bead cleanup
Add 40 µL of resuspended AMPure XP beads to each reaction in a PCR tube
Mix by pipetting 10x
Incubate 00:05:00 at Room temperature
Place on magnet
Wash 2x with 200 µL freshly-prepared 70 % (v/v) ethanol
Air dry for00:00:30 , don't allow the beads to become cracked
Remove the tubes from the magnetic rack
Add 50 µL 10 mM Tris-HCl pH 8.0 with 50 mM NaCl
NOTE: The BSA in the reaction causes the beads to clump.
Flick the tubes to partially resuspend the beads
Mix by pipetting 10x
Incubate 00:05:00 at Room temperature
Place on the magnet, aspirate 50 µL of the eluant into a new tube
Run 10 µL on a 0.8% agarose gel

10m 30s
Optional: Determine the proportion of amplicons with both Illumina adapters via qPCR
1m 50s
Library quantification can be done using a commercial kit such as the KAPA Library Quantification Kits or using the below custom protocol.

Dilute the cleaned up amplicons 1:100.
Make the master mix below using Illumina_quant_Inner primer set and a second master mix for Illumina_quant_Outer primer set.
AB
COMPONENTVolume (µl)
PowerUp SYBR Green Master Mix (2X)5
10µM Forward primer0.5
10µM Reverse primer0.5
Diluted amplicon2
Nuclease-Free Water2
qPCR master mix
Aliquot 8 µL to each well and add in 2 µL of the diluted amplicon.
ABCDE
StepTemp (C)Time (s)CyclesRamp Rate (C/s)
UDG activation5012012.73
Denaturation9512012.73
Denaturation9512.73
Amplification60302.11
Capture600
Melt Curve95112.73
602012.11
9510.15
Capture1
Cycle parameters for QuantStudio 3

The ratio of the Illumina _quant_Inner primer set to the Illumina _quant_Outer primer set will give the proportion of the DNA in the tube that contain both Illumina adapters and is sequencable (use this for pooling). While the melt curve will provide information on the proportion of each amplicon in the sample.
Expected Result
A) hissPCR generated amplicons using two forward and two reverse overlapping primers in a single tube. Amplicons contain either no Illumina adapter, one Illumina adapter, or two Illumina adapters per amplicon. B) The relative proportion of amplicons in the sample containing both Illumina adapters. C) Melt curves showing the expected amplicons for each primer set and the ratio of amplicons containing both Illumina adapters. D) An output from the hissPCR analysis pipeline showing the expected read coverage over the target area using 250bp Illumina sequencing. (see step 10 in protocol)
Depth and Pooling Calculations
The amount of amplicon to be pooled and loaded can be calculated using the Illumina Sequencing Coverage Calculator by selecting DNA input then custom content and
depends on numerous factors, including the amplicon size and number, and the kit and device used. An example output is shown below.
AB
Application or product:Custom Content
Genome or region size (Mbases)0.001
Read length600
On target (%)95
Coverage (x)50000
Duplicates (%)0
InstrumentMiSeq
Run typev3 Reagents
Clusters25,000,000 per flow cell
Output per unit (flow cell or lane)15,000,000,000 per flow cell
Exceeds maximum read length?Does not exceed maximum (2x300)
Number of units per sample (flow cell or lane)0.004 flow cells
Samples per unit (flow cell or lane)285/flow cell Most Illumina library prep kits enable up to 96 indexes; Nextera XT up to 384 indexes.
CommentsUpgraded software; MCS v2.3 or later; MiSeq Reagent Kit v3 (150/600)
ProductMiSeq Reagent Kit v3
Linkhttp://www.illumina.com/products/miseq-reagent-kit-v3.html
Illumina coverage estimator output.
Data Analysis
The sequence data can be performed using most amplicon processing pipelines; however, the primer sequences must be trimmed from the reads to eliminate their effect on mutation identification. We have developed a pipeline to process data which is available at hissPCR analysis with further details, below is its basic usage command.

bash hissPCR.sh \
--R1 "test_data/read_R1_001.fastq.gz" \
--R2 "test_data/read_R2_001.fastq.gz" \
--ref "refs/BDQ_duplex.fasta" \
--primers "refs/primers.bed" \

Protocol references
link to github