Feb 24, 2026
Highly sensitive Poliovirus RT-PCR - Environmental Samples
- Alison Tedcastle1,
- Yemisi Adedeji1,
- Aishwarya Arunagirinathan1,
- Erika Bujaki1,
- Javier Martin1
- 1MHRA
Protocol Citation: Alison Tedcastle, Yemisi Adedeji, Aishwarya Arunagirinathan, Erika Bujaki, Javier Martin 2026. Highly sensitive Poliovirus RT-PCR - Environmental Samples. protocols.io https://dx.doi.org/10.17504/protocols.io.j8nlk16jxg5r/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: February 10, 2026
Last Modified: February 24, 2026
Protocol Integer ID: 242973
Keywords: Poliovirus, DDNS, Direct detection, Environmental surveillance, Wastewater surveillance, minION, Enterovirus, PV, Nanopore sequencing , PCR, RT-PCR, Sensitive, poliovirus from environmental rna extract, magmax viral rna isolation large volume extraction protocol, sensitive poliovirus rt, poliovirus serotypes for surveillance, viral rna extraction section, magmax viral rna isolation, poliovirus serotype, poliovirus, viral rna, completion of the sensitive pcr assay, viral enrichment, sensitive pcr assay, environmental rna extract, using polio, pcr, wastewater sample, environmental samples this protocol, amplification of the vp1 region, nanopore, oxford nanopore, large volume extraction protocol, vp1 region, extraction
Abstract
This protocol outlines the amplification of the VP1 region of poliovirus from environmental RNA extracts using a semi-nested PCR approach. The method employs pan-enterovirus and poliovirus-specific primers, followed by targeted amplification of the VP1 region using polio-specific primer sets.
Wastewater samples should first be concentrated, for viral enrichment, using an appropriate concentration method. Viral RNA is then extracted according to the MagMAX Viral RNA Isolation Large Volume Extraction protocol, using 1.2 mL of concentrate per extraction (see Viral RNA Extraction section below).
Following completion of the sensitive PCR assay, resulting amplicons are pooled and purified in preparation for library construction for Oxford Nanopore or Illumina sequencing. Barcoding of amplicons prior to nanopore sequencing enables multiplexing of multiple samples in a single run, thereby reducing turnaround time and cost per sample.
This protocol supports the sensitive detection and recovery of all three poliovirus serotypes for surveillance and research applications.
Materials
- Nuclease-Free Water (Promega, Cat. No. P1193 or Merck, Cat. No. 3098)
- SuperScript‱ III One-Step RT-PCR System with Platinum‱ Taq High Fidelity DNA Polymerase (Invitrogen, Cat. No. 12574035)
- DreamTaq Hot Start PCR Master Mix (Thermo Scientific, Cat. No. K9011)
- Ethanol (96-100%)
- 0.2ml PCR tube strips
- 1.5 mL LoBind tubes (Eppendorf, Cat. No. 022431021)
- Gel electrophoresis agarose gel kit and buffers or Tapestation DNA kit
- Molecular weight marker (such as 1kb DNA Ladder, Promega, Cat. No. G571A)
- AMPure magnetic beads (Beckman Coulter, Cat. No. A63880)
- Qubit Broad Range dsDNA kit (Thermo Scientific, Cat. No. Q33853)
Troubleshooting
Before start
Viral RNA extraction
We recommend using the MagMAX Viral RNA Extraction method. Please follow the appropriate protocol depending on your starting material and manual or automated worklfow:
Purification of viral RNA from environmental samples using MagMAX Viral RNA Isolation Kit - https://www.protocols.io/view/large-volume-viral-rna-extraction-using-magmax-vir-81wgbzdr3gpk/v3
Using freshly extracted viral RNA is recommended whenever possible to facilitate successful amplification of long genome fragments.
Repeated freeze-thaw of samples or purified RNA can affect viral nucleic acid integrity, reducing amplification efficiency.
Poliovirus RT-PCR
Wipe down lab bench surfaces and pipettes with 70% ethanol and an RNAse cleaning agent, such as RNAse Zap.
Prepare a master mix using Superscript III One-Step RT-PCR System with Platinum Taq High Fidelity for primer set Y7R / AriR and nOPV2_MMR (See 'First' reaction, Appendix 1). The reaction volumes are detailed in the tables below and should be prepared for the number of samples together with positive, negative controls plus 10% (for pipetting loss), where appropriate.
Note
It is advised to use the RNA straight after extraction for best results. Storage and freeze-thawing may affect its quality.
Each sample should be tested in triplicates to increase detection sensitivity.
| A | B | |
| Poliovirus | Volume (µL) | |
| 2x Reaction Mix | 12.5 | |
| Anti-sense primer | 1 | |
| Enzyme Mix | 1 | |
| Water | 4.5 | |
| RNA | 8 | |
| Total volume | 24 |
Vortex the master mix briefly and spin down to gather contents at the bottom of the tube. Aliquot 16 µL into each PCR tube/strip.
Close the lids of the PCR tubes/strips and transfer the rack to the template addition room.
Add 4 µL of positive control or 8 µL sample RNA to the appropriate reaction tubes. Add 8 µL of nuclease free water for the negative control.
Place PCR sample tubes in the Thermocycler and run at 50 °C for 30 minutes.
After running the RT step, spin down samples and then add 1 µL of the forward primer into each tube.
Transfer the reaction tubes to the PCR room and run the following cycling conditions.
| A | B | |
| Profile: Poliovirus | ||
| 94°C for 2min | ||
| Cycles 42 | Step 1: 94°C for 15 secs | |
| Step 2: 55°C for 30 secs | ||
| Step 3: 68°C for 5 min | ||
| 68°C for 5 min | ||
| 10°C hold | ||
Note
At this point you can store the PCR products at -20°C. These can be stored indefinitely before continuing to step 11, however it is advised to continue the PCR protocol as soon as possible.
Second round PCR
Wipe down lab bench surfaces and pipettes with 70% ethanol and an DNAse cleaning agent, such as DNAse Zap.
Prepare master mixes using DreamTaq Hot Start PCR Master Mix using primer sets Y7/Q8 and PV1_VP1 + Sabin primers/Q8 (See 'Second_1' and 'Second_2' reactions in Appendix 1). The reaction volumes are detailed in the tables below and should be prepared for the number of samples together with positive, negative controls plus 10% (for pipetting loss), where appropriate.
| A | B | |
| Poliovirus | Volume (µL) | |
| 2x Reaction Mix | 12.5 | |
| Forward primer | 1 | |
| Reverse primer | 1 | |
| Water | 8.5 | |
| RNA | 2 * | |
| Total volume | 25 |
* See step 16.
Vortex the master mix briefly and spin down to gather contents at the bottom of the tube. Aliquot 23 µL of the master mix into each PCR tube/strip.
Close the lids of the PCR tubes/strips and transfer the rack to the template addition room.
Dilute the first round PCR product 1:10 in nuclease free water, then add 2 µL of this diluted product to the appropriate reaction tubes. Add 2 µL of nuclease free water for the negative control.
Place PCR sample tubes in the Thermocycler and run the below conditions relevant to the target.
Run the following cycling conditions.
| A | B | |
| Profile: Poliovirus | ||
| 94°C for 2min | ||
| Cycles 40 | Step 1: 94°C for 15 secs | |
| Step 2: 50°C for 30 secs | ||
| Step 3: 68°C for 1 min | ||
| 68°C for 5 min | ||
| 10°C hold | ||
Check all samples including positive and negative controls from the second round PCR on a 1% agarose gel. The expected band size for each target is in Appendix 1. Proceed to the next step with the confirmed positive reactions for purification and quantification of the DNA.
Amplicon pooling
Pool 7µL from each triplicate amplicon, 10µL from two positive reactions or 20µL from the only positive reaction (depending on successful amplification as noted in the gel) for each virus sample.
Note
We present a simplified approach here directed by electrophoresis results with purifying and quantifying the pooled reactions. Alternatively, each amplicon can be purified and quantified individually for accurate equimolar pooling.
Preparing input DNA
Allow AMPure beads to warm to room temperature then add an equal volume of beads to the individually pooled PCR samples and pipette gently to mix. For example, for a 21µL pooled sample add 21µL of resuspended beads
Incubate at room temperature for 5 minutes.
Spin down and place on a magnetic rack until clear and colourless, then pipette off the supernatant.
Whilst on the magnet, wash the beads with 100µL of 80% Ethanol, remove and discard.
Repeat Step 24.
Spin down the tubes and place back on the magnet to remove any residual Ethanol. Allow to air dry for about 30 seconds.
Remove the tubes from the magnetic rack and resuspend the pellet in 20µL nuclease free water and incubate at room temperature for 2 minutes.
Pellet the beads on the magnet and remove 20µL (or as much as possible) of each sample into a clean tube.
Quantitfy the purified DNA with a Qubit Broad Range dsDNA kit.
In brief, create a master mix of 200µL (199µL buffer, 1µL Qubit reagent) for each sample + 2 standards + 10 %.
For the two standards, add 190µL master mix to 10µL of standard, and for samples add 198µL master mix to 2µL sample.
Vortex each sample or standard once they are added to the master mix and incubate for 2 minutes before quantifying.
Note
Important - be sure to select the broad range kit on the Qubit
Record the concentration of DNA for each sample.
Transfer 200 fmol of DNA per sample into a clean 96-well plate and adjust volume to 12.5µL with nuclease free water. Mix gently by pipetting. For example, 200 fmol of a 900bp fragment = ~110ng*
Once aliquoted, spin down briefly.
Continue to step 5 in the native barcoding protocol for direct detection nanopore sequencing. https://dx.doi.org/10.17504/protocols.io.e6nvwjko9lmk/v1
Appendix 1: Primers (All primers should be at a working concentration of 10µM)
| A | B | C | D | E | |
| Target | Reaction | Primer name | Sequence | Reference | |
| Poliovirus (~900bp) | First | Y7R (forward) | GGTTTTGTGTCAGC[I]TGYAAYGA | 2 | |
| AriR (1) | TCAATACGGTGTTTGCTCTTGAACTG | 1 | |||
| nOPV2_MMR (1) | TCGATACGGTGCTTGGATTTAAATTG | ||||
| Second_1 | Y7 | GGGTTTGTGTCAGCCTGTAATGA | 2 | ||
| Q8 | AAGAGGTCTCTRTTCCACAT | 3 | |||
| Second_2 | PV1_VP1F (2) | GARARYATGATWGACAACACAGTYCG | 4 | ||
| Sabin1 (2) | GGTTAGGTCAGATGCTTGAAAGC | 4 | |||
| Sabin2 (2) | CTGCGAGATACAACACACATYAGT | 4 | |||
| Sabin3 (2) | CCACTCACATTTCACAATCTGCGC | 4 | |||
| Q8 | AAGAGGTCTCTRTTCCACAT | 3 |
* Prepare primer mixes to a working concentration of 10µM:
(1) AriR and nOPV2_MMR
(2) PV1_VP1F and all Sabin primers
All other primers should be at a working concentration of 10µM.
Protocol references
1. Arita M, Kilpatrick DR, Nakamura T, Burns CC, Bukbuk D, Oderinde SB, Oberste MS, Kew OM, Pallansch MA, Shimizu H. 2015. Development of an efficient entire-capsid-coding-region amplification method for direct detection of poliovirus from stool extracts. J Clin Microbiol 53:73–78.
2. Kilpatrick DR, Iber JC, Chen Q, Ching K, Yang S-J, De L, Mandelbaum MD, Emery B, Campagnoli R, Burns CC, Kew O. 2011. Poliovirus serotype-specific VP1 sequencing primers. J Virol Methods 174:128–130.
3. Yang, C.-F., De L., S-J Yang, J. Ruiz Gómez, J. R. Cruz, B. P. Holloway, M. A. Pallansch & O. M. Kew (1992).
“Genotype-specific in vitro amplification of sequences of the wild type 3 polioviruses from Mexico and Guatemala.” Virus Research, 24(3): 277–296.
4. Shaw, A. G., Majumdar, M., Troman, C., O’Toole, Á., Benny, B., Abraham, D., Praharaj, I., Kang, G., Sharif, S., Alam, M. M., Shaukat, S., Angez, M., Khurshid, A., Mahmood, N., Arshad, Y., Rehman, L., Mujtaba, G., Akthar, R., Salman, M., Klapsa, D., Hajarha, Y., Asghar, H., Bandyopadhyay, A., Rambaut, A., Martin, J., & Grassly, N. (2020).
Rapid and sensitive direct detection and identification of poliovirus from stool and environmental surveillance samples by use of nanopore sequencing. Journal of Clinical Microbiology, 58(9): e00920-20.