HiDEF-seq

Nisrine Jabara; Mei Hong Liu; Benjamin M. Costa; Emilia C. Bianchini; Una Choi; Rachel C. Bandler; Emilie Lassen; Marta Grońska-Pęski; Adam Schwing; Zachary R. Murphy; Daniel Rosenkjær; Shany Picciotto; Vanessa Bianchi; Lucie Stengs; Melissa Edwards; Nuno Miguel Nunes; Caitlin A. Loh; Tina K. Truong; Randall E. Brand; Tomi Pastinen; J. Richard Wagner; Anne-Bine Skytte; Uri Tabori; Jonathan E. Shoag; Gilad Evrony

Apr 20, 2026

Version 7

HiDEF-seq V.7

DOI

https://dx.doi.org/10.17504/protocols.io.kxygxy9mwl8j/v7

Nisrine Jabara¹,
Mei Hong Liu²,
Benjamin M. Costa²,
Emilia C. Bianchini²,
Una Choi²,
Rachel C. Bandler²,
Emilie Lassen³,
Marta Grońska-Pęski²,
Adam Schwing²,
Zachary R. Murphy²,
Daniel Rosenkjær³,
Shany Picciotto⁴,
Vanessa Bianchi⁵,
Lucie Stengs⁵,
Melissa Edwards⁵,
Nuno Miguel Nunes⁵,
Caitlin A. Loh²,
Tina K. Truong²,
Randall E. Brand⁶,
Tomi Pastinen⁷,
J. Richard Wagner⁸,
Anne-Bine Skytte³,
Uri Tabori⁵,
Jonathan E. Shoag⁴,
Gilad Evrony¹

¹NYU Grossman School of Medicine;
²New York University Grossman School of Medicine;
³Cryos International Sperm and Egg Bank;
⁴Case Western Reserve University School of Medicine;
⁵The Hospital for Sick Children;
⁶University of Pittsburgh School of Medicine;
⁷Children’s Mercy Kansas City;
⁸Université de Sherbrooke

Gilad Evrony

NYU Grossman School of Medicine

DOI: https://dx.doi.org/10.17504/protocols.io.kxygxy9mwl8j/v7

Protocol Citation: Nisrine Jabara, Mei Hong Liu, Benjamin M. Costa, Emilia C. Bianchini, Una Choi, Rachel C. Bandler, Emilie Lassen, Marta Grońska-Pęski, Adam Schwing, Zachary R. Murphy, Daniel Rosenkjær, Shany Picciotto, Vanessa Bianchi, Lucie Stengs, Melissa Edwards, Nuno Miguel Nunes, Caitlin A. Loh, Tina K. Truong, Randall E. Brand, Tomi Pastinen, J. Richard Wagner, Anne-Bine Skytte, Uri Tabori, Jonathan E. Shoag, Gilad Evrony 2026. HiDEF-seq. protocols.io https://dx.doi.org/10.17504/protocols.io.kxygxy9mwl8j/v7Version created by Gilad Evrony

License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited

Protocol status: Working

We use this protocol and it's working

Created: April 19, 2026

Last Modified: April 20, 2026

Protocol Integer ID: 315297

Keywords: HiDEF-seq, duplex sequencing, mutations, somatic mutations, SMaHT, genome profiling via random fragmentation, genome profiling, read sequencing, dna mismatch, version of the hidef, molecule fidelity, hidef, dna, molecule, long read sequencing, sequencing, seq, whole genome

Funders Acknowledgements:

SMaHT Network (NIH)

Grant ID: UH3NS132024

Abstract

This is the HiDEF-seq v3.1 library preparation protocol for bulk, single-molecule fidelity, long-read sequencing. This version of the HiDEF-seq protocol is designed for whole-genome profiling via random fragmentation and larger fragments than in our prior protocol for increased cost-efficiency. See our paper "DNA mismatch and damage patterns revealed by single-molecule sequencing" (Liu & Costa et al.) for more information.

Introduction

This is the HiDEF-seq v3 protocol for single-molecule sequencing with single-molecule fidelity on PacBio sequencers.

Fragmentation options:
This protocol enables genome-wide profiling by random fragmentation to ~4 kb fragments (Megaruptor 3 fragmentation only) or ~ 2 kb fragments (Megaruptor 3 + Bioruptor combined fragmentation). The latter results in a higher duplex efficiency after filtering at the cost of shorter fragments.

A-tailing options:
This protocol can be performed either with A-Tailing or without A-Tailing in the 'Klenow/PNK Reaction'.

No A-tailing is strongly recommended since the fragmentation methods detailed in this protocol can introduce single-strand nicks that are not repairable by nick ligation, leading to artifactual ssDNA N>A substitutions due to A-tailing. A-tailing should only be used when there is both high-quality DNA (per Tapestation analysis) and when an alternative fragmentation method has been validated to not introduce artifactual ssDNA signals.

Required Materials

Instruments
Instrument
SupplierProduct #
Megaruptor 3DiagenodeB06010003
Bioruptor PicoDiagenodeB01080010
NanoDrop OneThermo ScientificND-ONE-W
Qubit 4 FluorometerInvitrogenQ33226
4150 TapeStation SystemAgilentG2992AA
96S Super MagnetAlpaquaA001322
Mastercycler X50I Thermal CyclerEppendorf-
ThermoMixer CEppendorf-
Centrifuge 5424 REppendorf-
BenchMixer Vortex MixerBenchmark ScientificBV1000
Corning Mini CentrifugeCorning6770

Reagents and consumables
ItemSupplierProduct #KitKit #
DNA LoBind Tube 0.2mLAxygenPCR-02-L-C
DNA LoBind Tube 0.5mLEppendorf022431005
DNA LoBind Tube 1.5mLEppendorf022431021
Nuclease free waterThermo FisherAM9937
Molecular-grade ethanolFisher BP2818100 
1M Tris pH 8InvitrogenAM9855G
5M NaClPromegaV4221
10% SDS solutionInvitrogenAM9822
0.5M EDTAInvitrogenAM9260G
50mM β-Nicotinamide adenine dinucleotide (NAD+)NEBB9007S
100mM dATPThermo FisherR0141
10mM ddCTPJena BioscienceNU-101610mM ddNTP BundleNU-1019
10mM ddGTPJena BioscienceNU-101710mM ddNTP BundleNU-1019
10mM ddTTPJena BioscienceNU-101810mM ddNTP BundleNU-1019
Buffer SREPacific Biosciences102-280-900SRE Kit102-208-300
Megaruptor 3 Shearing KitHologic DiagenodeE07010003
Hydropore - short (2-9 kb)Hologic DiagenodeE07010001
0.65 ml Bioruptor Pico MicrotubesHologic DiagenodeC30010011
Tube holder for 0.65 ml tubesHologic DiagenodeB01201143
10X NEBuffer r1.1NEBB6001S
10X NEBuffer 4NEBB7004S
10X rCutSmart Buffer NEBB6004S
10X T4 DNA Ligase BufferNEBB0202S
10X Mung Bean Nuclease BufferTakara2420A
Mung Bean NucleaseTakara2420A
Nuclease P1NEBM0660S
T4 Polynucleotide Kinase (PNK)NEBM0201S
E. Coli DNA LigaseNEBM0205S
Klenow Fragment (3'→5' exo-)NEBM0212S
NEBNext Ultra II Ligation Master MixNEBE7648ANEBNext Ultra II Ligation Module E7595S
NEBNext Ligation EnhancerNEBE7374ANEBNext Ultra II Ligation ModuleE7595S
Exonuclease I (E. coli)NEBM0293S
RecJfNEBM0264S
T7 ExonucleaseNEBM0263S
Ampure PB BeadsPacific Biosciences100-265-900
Elution BufferPacific Biosciences101-633-500
SMRTbell adapter index plate 96A (for A-tailed libraries)Pacific Biosciences102-009-200
Barcoded non-overhang adapters (for non-A-tailed libraries)IDTCustom Order (see below table)
Qubit 1X dsDNA HS Assay KitThermo FisherQ33231
Qubit Assay TubesThermo FisherQ32856
Genomic DNA Ladder for ScreenTapeAgilent5190-6292Genomic DNA Reagents5067-5366
Genomic DNA Sample Buffer for ScreenTapeAgilent5190-6293Genomic DNA Reagents5067-5366
Genomic DNA ScreenTapeAgilent5067-5365
High Sensitivity D5000 Ladder for ScreenTapeAgilent5190-7747High Sensitivity D5000 Reagents5067-5593
High Sensitivity D5000 Sample Buffer for ScreenTapeAgilent5190-7745High Sensitivity D5000 Reagents5067-5593
High Sensitivity D5000 ScreenTapeAgilent5067-5592
Optical Tube Caps, 8x for ScreenTapeAgilent401425
Optical Tube Strips, 8x for ScreenTapeAgilent401428

 Barcoded non-overhang adapters (only for non-A-tailed libraries):
Order with HPLC purification

Adapter IDSequenceBarcode
bcAd2001  /5Phos/ATACTCGTCGCACGATCTTTTCCTCCTCCTCCGTTGTTGTTGTTGATCGTGCGACGAGTAT    ATCGTGCGACGAGTAT
bcAd2002  /5Phos/ATACTCATGACATGCACTTTTCCTCCTCCTCCGTTGTTGTTGTTGTGCATGTCATGAGTAT    TGCATGTCATGAGTAT
bcAd2003  /5Phos/ATACTCGAGCACTCGTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGACGAGTGCTCGAGTAT    ACGAGTGCTCGAGTAT
bcAd2004  /5Phos/ATACTCGAGCACTGCACTTTTCCTCCTCCTCCGTTGTTGTTGTTGTGCAGTGCTCGAGTAT    TGCAGTGCTCGAGTAT
bcAd2005  /5Phos/ATACTCGATCGAGTCACTTTTCCTCCTCCTCCGTTGTTGTTGTTGTGACTCGATCGAGTAT    TGACTCGATCGAGTAT
bcAd2006  /5Phos/ATACTCAGATCGCATGCTTTTCCTCCTCCTCCGTTGTTGTTGTTGCATGCGATCTGAGTAT    CATGCGATCTGAGTAT
bcAd2007  /5Phos/ATACTCAGATGCTAGTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGACTAGCATCTGAGTAT    ACTAGCATCTGAGTAT
bcAd2008  /5Phos/ATACTCAGACTAGCGTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGACGCTAGTCTGAGTAT    ACGCTAGTCTGAGTAT

 

DNA Quality Control

Measure sample input DNA library concentration, A260/A280, and A260/A230 using a NanoDrop instrument.

Measure sample input DNA library concentration using the Qubit 1X dsDNA HS Assay (Q33231).

Evaluate DNA quality:
Pure DNA will have an A260/280 absorbance ratio of 1.8, and an A260/230 ratio of 2.0 or higher.
Evaluate discordance between NanoDrop and Qubit measurement to assess for RNA contamination, and treat with RNase and cleanup if needed.
For challenging sample types that fail sequencing due to the presence of co-extracted inhibitors, use the DNeasy PowerClean Pro Cleanup Kit (Qiagen) to further clean the DNA per PacBio's recommendation.
See this note for additional details:
Technical-Note-Preparing-DNA-for-PacBio-HiFi-Sequencing-Extraction-and-Quality-Control.pdf4.4MB  

Measure sample input DNA size distribution with the Genomic DNA ScreenTape assay (5067-5366 and 5067-5593).
Samples with low DNA Integrity Numbers (i.e., fragmented DNA) should be prepared as non-A-tailed libraries to avoid fragmentation-related ssDNA artifacts.
For highly degraded DNA, skip the 'SRE cleanup' step and perform instead the '0.75 X Size Selection with 75% Diluted Beads' step.
Samples with high DNA Integrity Numbers can also be prepared as non-A-tailed libraries if sufficient input DNA is available (see SRE cleanup section for recommended input DNA amounts).

Prepare reagents

80% Ethanol:
ComponentStarting ConcentrationFinal ConcentrationInput (mL)
Ethanol (BP2818100)100 %80 %8
Nuclease Free Water (AM9937)2
Total10

Vortex mix

10 mM Tris pH8:
ComponentStarting ConcentrationFinal ConcentrationInput (µL)
Nuclease Free Water (AM9937)990
1 M Tris pH 8 (AM9855G)1000 mM10 mM10
Total1000

Vortex mix

10 X Annealing Buffer:
ComponentStarting ConcentrationFinal ConcentrationInput (µL)
Nuclease Free Water (AM9937)400
1 M Tris pH 8 (AM9855G)1000 mM100 mM50
5 M NaCl (V4221)5000 mM500 mM50
Total500

Vortex mix

1 X Shearing Buffer :
ComponentStarting ConcentrationFinal ConcentrationInput (µL)
Nuclease Free Water (AM9937)988
1 M Tris pH 8 (AM9855G)1000 mM10 mM10
5 M NaCl (V4221)5000 mM10 mM2
Total1000

Vortex mix

1 % SDS:
ComponentStarting ConcentrationFinal ConcentrationInput (µL)
Nuclease Free Water (AM9937)900
SDS, 10 % Solution, RNase-free (AM9822)10 %1 %100
Total1000

Pipette mix and spin down

500 µM NAD+:
ComponentStarting ConcentrationFinal ConcentrationInput (µL)
Nuclease Free Water (AM9937)198
β-Nicotinamide adenine dinucleotide (NAD+) (B9007S)50 mM500 µM2
Total200

Pipette mix and spin down
Split into 10 µL aliquots and store at -80C

1 mM dATP / ddBTP Mix (only for A-tailed libraries): 
ComponentStarting ConcentrationFinal ConcentrationInput (µL)
Nuclease Free Water (AM9937)69
100 mM dATP (R0141)100 mM1 mM1
10 mM ddCTP (NU-1016)10 mM1 mM10
10 mM ddGTP (NU-1017)10 mM1 mM10
10 mM ddTTP (NU-1018)10 mM1 mM10
Total100

Pipette mix and spin down
Store at -20C

1 mM ddBTP Mix (only for non-A-tailed libraries): 
ComponentStarting ConcentrationFinal ConcentrationInput (µL)
Nuclease Free Water (AM9937)21
10 mM ddCTP (NU-1016)10 mM1 mM3
10 mM ddGTP (NU-1017)10 mM1 mM3
10 mM ddTTP (NU-1018)10 mM1 mM3
Total30

Pipette mix and spin down
Store at -20C

75% Diluted Ampure PB Beads (only for highly degraded DNA libraries that skip 'SRE Cleanup'):
ComponentInput (uL)
Elution Buffer (101-633-500)250
Ampure PB Beads (100-265-900)750
Total1000

Vortex mix

Prepare barcoded non-overhang adapters (only for non-A-tailed libraries)

If not previously performed, reconstitute adapters to 100 µM as follows:
Add 10 * (nmoles listed on tube) µL of nuclease-free water
Let sit at room temperature for 3 min to avoid losing dry oligo
Vortex mix to ensure capture of all dry oligo
Spin down
Split into aliquots in DNA LoBind tubes to limit each aliquot to 10 freeze-thaw cycles

Make 20 µM annealed adapters in 0.2 mL DNA LoBind tubes (perform for each barcoded adapter) as follows:
ComponentsStarting ConcentrationFinal ConcentrationInput (µL)
Nuclease-Free Water (AM9937)14.00
10 X Annealing Buffer10 X1 X2.00
100 µM Barcoded non-overhang adapter100 µM20 µM4.00
Total20.00
Pipette mix and spin down

Run Hairpin Annealing thermocycler protocol:
Heated lid on at 105°C
95 °C   hold

Place the 20 µM adapter dilution on the thermocycler for 3 mins, and then immediately transfer the adapter to room temperature for 30 mins.
Measure volume and add enough nuclease free water to bring the final volume back to 20 µL.
Transfer volume into a 1.5 mL DNA LoBind tube and store at -20C.
Limit annealed adapters to 2 freeze-thaw cycles.

SRE Cleanup (removes small DNA fragments): Optional

Important: For high-quality DNA, this 'SRE cleanup' step can be optionally performed to improve the size distribution (i.e. make it more narrow) of the library. Do not perform this on low-quality DNA, since this step would lose most of the DNA.

Prepare DNA sample:
In 0.5 mL DNA LoBind tubes
ComponentInput (µL)Final Amount (ng)
Nuclease Free Water (AM9937)50 - X
DNA sampleXSee recommended input below
Total50
Calculation for DNA Sample volume (X) = [ng input] / [DNA Sample Concentration in ng / µL]
Recommended input for A-tailing samples: 3000 ng
Recommended input for non-A-tailing samples: 4000 ng
Note: For less concentrated DNA, SRE reaction volume can be increased to allow DNA input at the recommended amount. Scale Buffer SRE volume accordingly to maintain a 1:1 ratio to DNA volume. 

Add 50 µL of Buffer SRE (102-280-900). Vortex and spin down.

Incubate on Thermomixer:
01:00:00   37 °C   0 rpm  

Spin Down on Centrifuge
10000 x g, 24°C, 00:30:00  

Resuspend SRE Pellet
Carefully remove the supernatant from tube without disturbing the DNA pellet
Add 90 µL of 1 X Shearing Buffer to the bottom of the tube without touching the bottom of the tube with pipette tip. Incubate at room temperature for 10 minutes.
Pipet mix 20x. Spin down briefly. Incubate at room temperature for 5 minutes.
Vortex tube at ¾ of max speed for 10 seconds and then spin down briefly.
Measure the sample volume and add additional 1 X Shearing Buffer if necessary for a final sample volume of 100 µL.
Pipet mix 20x. Spin down briefly.
Keep DNA on ice.

0.75X Size Selection with 75% Diluted Beads

Important: Perform this step only for highly degraded DNA, instead of the 'SRE cleanup' step.

Add 75% Diluted Ampure PB Beads at a 0.75X bead to sample volume ratio.
Wash twice with 180 µL 80% Ethanol
Elute with 101 µL of 1X Shearing Buffer and transfer 100 µL to a new 0.2 mL DNA LoBind tube

Fragmentation

Below we provide instructions for DNA fragmentation to ~ 4 kb using the Megaruptor 3 alone, or to ~ 2 kb using Megaruptor 3 + Bioruptor combined fragmentation.

Resources:
Megaruptor 3 Manual: Megaruptor 3 Manual.pdf3.2MB  
Setting up samples in Megaruptor 3: https://www.youtube.com/watch?v=zVhqnkQL8zo

Bioruptor Pico Manual: Bioruptor Pico Manual.pdf  
Setting up samples in Bioruptor Pico: https://www.youtube.com/watch?v=-LXE9WgfUDY

Megaruptor pre-assembled consumables contain long hydropores (E07010002, black). Replace the long hydropores with short hydropores (E07010001, white) as follows:
Holding the top of the syringe, gently and steadily twist the long hydropore in a counterclockwise motion to remove the hydropore.
Holding the top of the syringe, fasten a short hydropore to the syringe by gently and steadily twisting in a clockwise motion.
Ensure the syringe plunger is fully compressed to remove any air.
Tighten the syringe, adaptor, and hydropore components together securely.

Components of the megaruptor consumable:
Megaruptor Consumable.png46.7KB  

Transfer the DNA sample to the hydro tube.

Prepare Megaruptor shearing parameters as follows:

Standard Megaruptor
Concentration (ng/µL)Volume (µL)Speed
4010065

Ultra-Fast Protocol (UFP) Activated Megaruptor
Volume (µL)SpeedPassesPause (s)
10065205

Run shearing protocol on Megruptor:
Connect the hydro tube to the hydropore syringe by inserting it carefully—no screwing required.
Load the syringe with the sample on the instrument.
For Standard Megaruptor: run the protocol 3 times (total shearing time is ~90 minutes, 30 minutes per run)
For Ultra-Fast Protocol (UFP) Activated Megaruptor: run the protocol 5 times (total shearing time is ~15 minutes, 3 minutes per run)

Attaching the hydrotube to the megaruptor consumable:
Hydropore Attachment.png61.3KB  

Remove samples from Megaruptor
Hold down the plunger while removing the syringe assembly from the megaruptor instrument.
While holding down the plunger, vigorously flick down the consumable so that liquid pools at the bottom of the hydropore.
While holding down the plunger, unplug the hydropore from the hydrotube slowly by tilting the syringe (hold the hydropore). Pull the tubing slowly from the liquid surface.
Press the syringe plunger maximally in order to recover the remaining volume of sample inside the hydropore tubing.
Slowly lower the hydropore tubing until it comes in contact with the surface of the liquid. The drop will be instantly added to the sample.
Additional volume may be removed with a P10 pipette from the lower part of the syringe after unscrewing the syringe from the adapter.
Spin down hydro tubes for 5 seconds.

Tips for sample recovery from megaruptor:
Recover_maximum_sample_volume_after_Mega3_shearing.pdf450.9KB 

If performing Megaruptor 3 fragmentation only:
Pipette the sheared sample from the hydro tube into a new 0.2 mL DNA LoBind tube
Proceed to 'Nuclease P1 Reaction' or 'Takara Mung Bean Nuclease Reaction'.
Sample may be stored at 4C for up to 24 hours before proceeding.

If performing Megaruptor 3 + Bioruptor combined fragmentation:
Pipette the sheared sample from the hydro tube into a new 0.65 mL Bioruptor tube.
Proceed to next step.

Measure the volume of each sample post-fragmentation and bring up to 100 µL with Nuclease Free Water (AM9937).

Prepare Bioruptor sonication parameters as follows:

Easy Mode
Sonication ONSonication OFFNumber of CyclesType of Tubes
5 seconds30 seconds10.65 mL

Run Bioruptor sonication protocol:
Place sample tubes in the 0.65mL tube holder
Never leave empty spaces in the tube holder. If necessary, fill the empty spaces with tubes containing the same volume of water.
Screw the lid on the tube holder without over-tightening it.
Place the tube holder in the sonication bath.
Run the protocol 1 time.
Remove the tube holder from the sonication bath and unscrew the lid.
Spin down microtube for 5 seconds.
Pipette the sample from the 0.65mL microtube into a new 0.2 mL DNA LoBind tube.
Proceed to 'Nuclease P1 Reaction' or 'Takara Mung Bean Nuclease Reaction'.
Sample may be stored at 4C for up to 24 hours before proceeding.

Nuclease P1 Reaction

Important: Perform either this Nuclease P1 end repair step or the Takara Mung Bean Nuclease end repair step, not both. Takara Mung Bean Nuclease typically has higher yield compared to Nuclease P1. Nuclease P1 is recommended when Takara Mung Bean Nuclease is unavailable, as Takara enzyme is not readily available in the United States and NEB Mung Bean Nuclease does not perform as well.

Prepare Nuclease P1 reaction as follows:
Measure the volume of each sample post-fragmentation and update the table accordingly
Note: Expect around 10 % volume loss
ComponentStarting ConcentrationFinal ConcentrationInput (µL)
Fragmented DNAX
Nuclease Free Water (AM9937)115 - X - 11.5 - 0.58
NEBuffer r1.1 (B6001S)10 X1 X11.50
Nuclease P1 (M0660S)100 U / µL0.5 U / µL0.58
Total115

Pipette mix and spin down

Run Nuclease P1 Reaction on the thermocycler:
Heated lid off
37 °C   00:30:00   ->4 °C   Hold

Inactivate Nuclease P1 Reaction
Add 4.5 µL of 0.5 M EDTA (AM9260G)
Pipette mix and spin down
Immediately add 1.2 µL of 1 % SDS dilution
Pipette mix and spin down

For Megaruptor 3 fragmentation only libraries:
Perform a 1.5 X bead cleanup
Transfer sample to a new 0.5mL DNA LoBind tube
Add 181 µL Ampure PB Beads (100-265-900)
Wash twice with 360 µL 80 % Ethanol
Elute with 22 µL of 10 mM Tris pH 8 and transfer 22 µL to a new 0.2 mL DNA LoBind tube

For Megaruptor 3 + Bioruptor combined fragmentation libraries:
Perform a 0.8 X bead cleanup
Transfer sample to a new 0.5mL DNA LoBind tube
Add 96.6 µL Ampure PB Beads (100-265-900)
Wash twice with 360 µL 80 % Ethanol
Elute with 22 µL of 10 mM Tris pH 8 and transfer 22 µL to a new 0.2 mL DNA LoBind tube

Takara Mung Bean Nuclease Reaction

Important: Perform either this Takara Mung Bean Nuclease end repair step or the Nuclease P1 end repair step, not both. Takara Mung Bean Nuclease typically has higher yield compared to Nuclease P1.

Prepare Takara Mung Bean reaction as follows:
Measure the volume of each sample post-shearing and update the table accordingly
Note: Expect around 10 % volume loss
ComponentStarting ConcentrationFinal ConcentrationInput (µL)
Fragmented DNAX
Nuclease Free Water (AM9937)115 - X - 11.5 - 1.44
10X Mung Bean Nuclease Buffer (Takara 2420A)10 X1 X11.50
Mung Bean Nuclease (Takara 2420A)40 U / µL0.5 U / µL1.44
Total115

Pipette mix and spin down

Run Mung Bean Nuclease Reaction on thermocycler:
Heated lid off
37 °C   00:10:00   ->4 °C   Hold

Inactivate Takara Mung Bean Reaction
Add 4.5 µL of 0.5 M EDTA (AM9260G)
Pipette mix and spin down
Immediately add 1.2 µL of 1 % SDS dilution
Pipette mix and spin down

For Megaruptor 3 fragmentation only libraries:
Perform a 1.5 X bead cleanup
Transfer sample to a new 0.5mL DNA LoBind tube
Add 181 µL Ampure PB Beads (100-265-900)
Wash twice with 360 µL 80 % Ethanol
Elute with 22 µL of 10 mM Tris pH 8 and transfer 22 µL to a new 0.2 mL DNA LoBind tube

For Megaruptor 3 + Bioruptor combined fragmentation libraries:
Perform a 0.8 X bead cleanup
Transfer sample to a new 0.5mL DNA LoBind tube
Add 96.6 µL Ampure PB Beads (100-265-900)
Wash twice with 360 µL 80 % Ethanol
Elute with 22 µL of 10 mM Tris pH 8 and transfer 22 µL to a new 0.2 mL DNA LoBind tube

E. Coli Nick Ligation

Prepare E. Coli Nick Ligation reaction as follows:
ComponentStarting ConcentrationFinal ConcentrationInput (µL)
Post-End Repair DNA22.00
Nuclease Free Water (AM9937)1.14
rCutSmart Buffer (B6004S)10 X1 X2.90
500 µM NAD+ dilution500 µM26 µM1.51
E. Coli DNA Ligase (M0205S)10 U / µL0.5 U / µL1.45
Total29.00

Pipette mix and spin down

Run E. Coli Nick Ligation Thermocycler Protocol:
Heated lid off
16 °C   00:30:00   ->4 °C   Hold

Klenow/PNK Reaction

Prepare Klenow/PNK reaction as follows:
Add dATP/ddBTP Mix for A-tailed libraries and ddBTP Mix for non-A-tailed libraries.
ComponentStarting Conc.Final Conc.A-tailed lib input (µL)Non A-tailed lib input (µL)
Post Nick Ligation DNA29.0029.00
Nuclease Free Water (AM9937)2.352.35
10X T4 DNA Ligase Buffer (B0202S)10 X1 X4.504.50
dATP/ddBTP Mix1 mM each0.1 mM each4.50-
ddBTP Mix1 mM each0.1 mM each-4.50
Klenow Fragment (3'→5' exo-) (M0212S)5 U / µL0.35 U / µL3.153.15
T4 PNK (M0201S)10 U / µL0.33 U / µL1.501.50
Total45.0045.00

Pipette mix and spin down

Run Klenow/PNK Thermocycler Protocol:
Heated lid off
 37 °C   00:30:00   ->4 °C   Hold

Adaptor Ligation

Prepare Adaptor Ligation reaction as follows:
The type of adapter to use depends on the library type: Use 'SMRTbell adapter index plate 96A' adapters for A-tailed libraries and annealed non-overhang adapters for non-A-tailed libraries. Both adapter types are 20 µM, yielding 0.88 µM in the ligation reaction.
ComponentInput (µL)
Post Klenow Reaction DNA45.00
Nuclease Free Water (AM9937)0.56
Barcoded adapter (type depends on A-tailed vs non-A-tailed library)3.19
NEBNext Ultra II Ligation Master Mix (E7648A)23.00
NEBNext Ligation Enhancer (E7374A)0.75
Total72.50

Pipette mix and spin down

Run Adaptor Ligation Thermocycler Protocol:
Heated lid off
20 °C   01:00:00   ->4 °C   Hold

Perform a 1.1 X bead cleanup:
Add 80 µL Ampure PB Beads (100-265-900)
Incubate with beads for 15 minutes.
Wash twice with 200 µL 80% Ethanol
Elute with 41 µL of 10 mM Tris pH 8 and transfer 40 µL to a new 0.2 mL DNA LoBind tube

Nuclease Treatment

Prepare Nuclease Treatment reaction as follows:
ComponentStarting ConcentrationFinal ConcentrationInput (µL)
Ligated DNA40.0
NEBuffer 4 (B7004S)10 X1 X5.00
Exonuclease I (M0293S)20 U / µL0.29 U / µL0.73
RecJF (M0264S)30 U / µL0.86 U / µL1.43
T7 Exonuclease (M0263S)10 U / µL0.57 U / µL2.85
Total50.0

Pipette mix and spin down

Run Nuclease Digestion on thermocycler:
Heated lid off
37 °C   00:30:00   ->4 °C   Hold

For SRE-treated A-tailed libraries:
Perform a 1 X Bead Clean
Add 50 µL Ampure PB Beads (100-265-900)
Incubate with beads for 15 minutes.
Wash twice with 80 % Ethanol
Elute with 24 µL of 10 mM Tris pH 8 and transfer 24 µL to a new 0.5 mL DNA LoBind tube

For SRE-treated non-A-tailed libraries:
Perform a 0.9 X Bead Clean
Add 45 µL Ampure PB Beads (100-265-900)
Incubate with beads for 15 minutes.
Wash twice with 80 % Ethanol
Elute with 24 µL of 10 mM Tris pH 8 and transfer 24 µL to a new 0.5 mL DNA LoBind tube

For non-SRE-treated libraries:
Perform a 0.75 X Bead Clean with 75% Diluted Beads
Add 37.5 µL 75% Diluted Ampure PB Beads
Incubate with beads for 15 minutes.
Wash twice with 80 % Ethanol
Elute with 24 µL of 10 mM Tris pH 8 and transfer 24 µL to a new 0.5 mL DNA LoBind tube

Library Quality Control

Measure library concentration by inputting 1 µL into the Qubit 1X dsDNA HS Assay (Q33231).
Expected concentration: 1 - 5 ng / µL

Combine 190 µL Qubit Working Solution with 10 µL Qubit Standard 1 in a Qubit assay tube
Combine 190 µL Qubit Working Solution with 10 µL Qubit Standard 2 in a Qubit assay tube
Combine 199 µL Qubit Working Solution with 1 µL Library in a Qubit assay tube
Vortex mix and incubate at room temperature for 2 minutes, then proceed to quantification

Measure library size distribution with High Sensitivity D5000 ScreenTape (5067-5592).
Combine 2 µL High Sensitivity D5000 Sample Buffer (5190-7745) with 2 µL High Sensitivity D5000 Ladder (5190-7747) in the first well of a tapestation optical strip tube
For each sample, combine 2 µL High Sensitivity D5000 Sample Buffer (5190-7745) + 2 µL Library in remaining wells
Vortex at 2000 rpm for 1 min and spin down briefly, then proceed to tapestation measurement

Example result of a Megaruptor fragmentation only library:

Example result of a Megaruptor + Bioruptor combined fragmentation library:

If there is a small amount of residual adapter dimers, these will be removed during the clean-up of the polymerase binding step prior to sequencing. However, if there is concern the adapter dimer is too much, then an additional 1 X bead cleanup can be performed.

Library may be stored at 4C for up to 24 hours. Place at -20C for long term storage. 

Sequencing

Multiplex libraries using Qubit quantification results.

Perform ABC (sequencing polymerase annealing/binding/cleanup) per the PacBio SMRTbell prep kit 3.0 manual.

Run on PacBio Revio instrument per the following example sample CSV configuration:
Modify this as needed if running > 1 SMRTcell in the same run
[Run Settings]
Instrument Type,Revio
Run Name,[Run name]
Plate 1,[Plate ID]
CSV Version,1

[SMRT Cell Settings],1_A01
Well Name,[Run name]
Application,Other
Library Type,Standard
Movie Acquisition Time (hours),30
Insert Size (bp),[Average size from ScreenTape]
Assign Data To Project,1
Library Concentration (pM),300
Include Base Kinetics,TRUE
Bio Sample Name,[Run name]
Sample is indexed,FALSE
Use Adaptive Loading,TRUE
Consensus Mode,strand
Full Resolution Base Qual,TRUE
Subread To HiFi Pileup,TRUE

Protocol references

DNA mismatch and damage patterns revealed by single-molecule sequencing
Liu MH*, Costa B*, Bianchini EC, Choi U, Bandler RC, Lassen E, Grońska-Pęski M, Schwing A, Murphy ZR, Rosenkjær D, Picciotto S, Bianchi V, Stengs L, Edwards M, Nunes NM, Loh CA, Truong TK, Brand RE, Pastinen T, Wagner JR, Skytte AB, Tabori U, Shoag JE, Evrony GD
Nature | 2024

Instrument	Supplier	Product #
Megaruptor 3	Diagenode	B06010003
Bioruptor Pico	Diagenode	B01080010
NanoDrop One	Thermo Scientific	ND-ONE-W
Qubit 4 Fluorometer	Invitrogen	Q33226
4150 TapeStation System	Agilent	G2992AA
96S Super Magnet	Alpaqua	A001322
Mastercycler X50I Thermal Cycler	Eppendorf	-
ThermoMixer C	Eppendorf	-
Centrifuge 5424 R	Eppendorf	-
BenchMixer Vortex Mixer	Benchmark Scientific	BV1000
Corning Mini Centrifuge	Corning	6770

Item	Supplier	Product #	Kit	Kit #
DNA LoBind Tube 0.2mL	Axygen	PCR-02-L-C
DNA LoBind Tube 0.5mL	Eppendorf	022431005
DNA LoBind Tube 1.5mL	Eppendorf	022431021
Nuclease free water	Thermo Fisher	AM9937
Molecular-grade ethanol	Fisher	BP2818100
1M Tris pH 8	Invitrogen	AM9855G
5M NaCl	Promega	V4221
10% SDS solution	Invitrogen	AM9822
0.5M EDTA	Invitrogen	AM9260G
50mM β-Nicotinamide adenine dinucleotide (NAD+)	NEB	B9007S
100mM dATP	Thermo Fisher	R0141
10mM ddCTP	Jena Bioscience	NU-1016	10mM ddNTP Bundle	NU-1019
10mM ddGTP	Jena Bioscience	NU-1017	10mM ddNTP Bundle	NU-1019
10mM ddTTP	Jena Bioscience	NU-1018	10mM ddNTP Bundle	NU-1019
Buffer SRE	Pacific Biosciences	102-280-900	SRE Kit	102-208-300
Megaruptor 3 Shearing Kit	Hologic Diagenode	E07010003
Hydropore - short (2-9 kb)	Hologic Diagenode	E07010001
0.65 ml Bioruptor Pico Microtubes	Hologic Diagenode	C30010011
Tube holder for 0.65 ml tubes	Hologic Diagenode	B01201143
10X NEBuffer r1.1	NEB	B6001S
10X NEBuffer 4	NEB	B7004S
10X rCutSmart Buffer	NEB	B6004S
10X T4 DNA Ligase Buffer	NEB	B0202S
10X Mung Bean Nuclease Buffer	Takara	2420A
Mung Bean Nuclease	Takara	2420A
Nuclease P1	NEB	M0660S
T4 Polynucleotide Kinase (PNK)	NEB	M0201S
E. Coli DNA Ligase	NEB	M0205S
Klenow Fragment (3'→5' exo-)	NEB	M0212S
NEBNext Ultra II Ligation Master Mix	NEB	E7648A	NEBNext Ultra II Ligation Module	E7595S
NEBNext Ligation Enhancer	NEB	E7374A	NEBNext Ultra II Ligation Module	E7595S
Exonuclease I (E. coli)	NEB	M0293S
RecJf	NEB	M0264S
T7 Exonuclease	NEB	M0263S
Ampure PB Beads	Pacific Biosciences	100-265-900
Elution Buffer	Pacific Biosciences	101-633-500
SMRTbell adapter index plate 96A (for A-tailed libraries)	Pacific Biosciences	102-009-200
Barcoded non-overhang adapters (for non-A-tailed libraries)	IDT	Custom Order (see below table)
Qubit 1X dsDNA HS Assay Kit	Thermo Fisher	Q33231
Qubit Assay Tubes	Thermo Fisher	Q32856
Genomic DNA Ladder for ScreenTape	Agilent	5190-6292	Genomic DNA Reagents	5067-5366
Genomic DNA Sample Buffer for ScreenTape	Agilent	5190-6293	Genomic DNA Reagents	5067-5366
Genomic DNA ScreenTape	Agilent	5067-5365
High Sensitivity D5000 Ladder for ScreenTape	Agilent	5190-7747	High Sensitivity D5000 Reagents	5067-5593
High Sensitivity D5000 Sample Buffer for ScreenTape	Agilent	5190-7745	High Sensitivity D5000 Reagents	5067-5593
High Sensitivity D5000 ScreenTape	Agilent	5067-5592
Optical Tube Caps, 8x for ScreenTape	Agilent	401425
Optical Tube Strips, 8x for ScreenTape	Agilent	401428

Adapter ID	Sequence	Barcode
bcAd2001	/5Phos/ATACTCGTCGCACGATCTTTTCCTCCTCCTCCGTTGTTGTTGTTGATCGTGCGACGAGTAT	ATCGTGCGACGAGTAT
bcAd2002	/5Phos/ATACTCATGACATGCACTTTTCCTCCTCCTCCGTTGTTGTTGTTGTGCATGTCATGAGTAT	TGCATGTCATGAGTAT
bcAd2003	/5Phos/ATACTCGAGCACTCGTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGACGAGTGCTCGAGTAT	ACGAGTGCTCGAGTAT
bcAd2004	/5Phos/ATACTCGAGCACTGCACTTTTCCTCCTCCTCCGTTGTTGTTGTTGTGCAGTGCTCGAGTAT	TGCAGTGCTCGAGTAT
bcAd2005	/5Phos/ATACTCGATCGAGTCACTTTTCCTCCTCCTCCGTTGTTGTTGTTGTGACTCGATCGAGTAT	TGACTCGATCGAGTAT
bcAd2006	/5Phos/ATACTCAGATCGCATGCTTTTCCTCCTCCTCCGTTGTTGTTGTTGCATGCGATCTGAGTAT	CATGCGATCTGAGTAT
bcAd2007	/5Phos/ATACTCAGATGCTAGTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGACTAGCATCTGAGTAT	ACTAGCATCTGAGTAT
bcAd2008	/5Phos/ATACTCAGACTAGCGTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGACGCTAGTCTGAGTAT	ACGCTAGTCTGAGTAT

Component	Starting Concentration	Final Concentration	Input (mL)
Ethanol (BP2818100)	100 %	80 %	8
Nuclease Free Water (AM9937)			2
Total			10

	Component	Input (uL)
	Elution Buffer (101-633-500)	250
	Ampure PB Beads (100-265-900)	750
	Total	1000

Components	Starting Concentration	Final Concentration	Input (µL)
Nuclease-Free Water (AM9937)			14.00
10 X Annealing Buffer	10 X	1 X	2.00
100 µM Barcoded non-overhang adapter	100 µM	20 µM	4.00
Total			20.00

Component	Input (µL)	Final Amount (ng)
Nuclease Free Water (AM9937)	50 - X
DNA sample	X	See recommended input below
Total	50

	Sonication ON	Sonication OFF	Number of Cycles	Type of Tubes
	5 seconds	30 seconds	1	0.65 mL

Component	Starting Conc.	Final Conc.	A-tailed lib input (µL)	Non A-tailed lib input (µL)
Post Nick Ligation DNA			29.00	29.00
Nuclease Free Water (AM9937)			2.35	2.35
10X T4 DNA Ligase Buffer (B0202S)	10 X	1 X	4.50	4.50
dATP/ddBTP Mix	1 mM each	0.1 mM each	4.50	-
ddBTP Mix	1 mM each	0.1 mM each	-	4.50
Klenow Fragment (3'→5' exo-) (M0212S)	5 U / µL	0.35 U / µL	3.15	3.15
T4 PNK (M0201S)	10 U / µL	0.33 U / µL	1.50	1.50
Total			45.00	45.00

	Component	Input (µL)
	Post Klenow Reaction DNA	45.00
	Nuclease Free Water (AM9937)	0.56
	Barcoded adapter (type depends on A-tailed vs non-A-tailed library)	3.19
	NEBNext Ultra II Ligation Master Mix (E7648A)	23.00
	NEBNext Ligation Enhancer (E7374A)	0.75
	Total	72.50