Feb 28, 2025
HCASMC CRISPRi TSS perturbseq
This protocol is a draft, published without a DOI.
- Daniel Li1,
- Quanyi Zhao1,
- Jesse Engreitz1,
- Parse Biosciences1
- 1Stanford
Protocol Citation: Daniel Li, Quanyi Zhao, Jesse Engreitz, Parse Biosciences 2025. HCASMC CRISPRi TSS perturbseq. protocols.io https://protocols.io/view/hcasmc-crispri-tss-perturbseq-d4tt8wnn
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: In development
We are still developing and optimizing this protocol
Created: February 27, 2025
Last Modified: February 28, 2025
Protocol Integer ID: 123475
Keywords: hcasmc crispri tss, crispr interference, seq experiment in human coronary artery, regulatory elements in hcasmc, crispr, using crispri, hcasmc, analyzing gene expression, smooth muscle cell, gene expression, human coronary artery, virus transduction, crispri, seq experiment, seq technology
Abstract
This protocol outlines the steps for conducting a CRISPR interference (CRISPRi) TSS perturb-seq experiment in human coronary artery smooth muscle cells (HCASMCs). The procedure includes virus transduction, MOI titration, and detailed instructions for setting up and running the experiment. . The protocol ensures accurate quantification of target sequences and reference controls. This method provides a robust framework for analyzing gene expression and regulatory elements in HCASMCs using CRISPRi and Perturb-seq technologies.
Troubleshooting
Library cloning for guides
- Vector Preparation CROP-seq-opti for TSS perturbseq
TSS perurbseq:
Digest Crop-Opti with BsmBI
| µL per reaction | ||
| NEB Buffer 3.1 (10X) | 10 µL | |
| 20 µg plasmid (1271 ng/µL) | 15.7 µL | |
| BsmBI-v2 | 4 µL | |
| Water | 70.3 µL | |
| Total | 100 µL |
- Incubate at 55ºC overnight (16 h) -- started at 4 pm on 8/4/21.
- Next morning, spike in 4 µL BsmBI-v2 to the tube and continue incubating at 55ºC for several more hours -- from 9:30 am to 5:00 pm on 8/5/21 (total 25 h).
0.7X SPRI (Ampure XP) clean up
- Pre-warm beads from 4ºC to room temperature.
- Add 70 µL SPRI to the tube, pipette to mix, and incubate for 10 min.
- Wash with 150 µL 70% ethanol twice.
- Remove ethanol and air dry for 10 min.
- Add 89 µL water and heat 37°C for 10 min.
- Put on magnet and transfer eluate (89 µL) to a new tube.
- (Store at -20°C)
Digest Crop-Opti with ClaI
- Add enzyme last
| µL per reaction | ||
| Cutsmart | 10 µL | |
| Eluate | 89 µL | |
| ClaI | 1 µL | |
| Total | 100 µL |
- Incubate at 37ºC overnight (16 h) -- start at 5:30 pm on 8/5/21.
- Next morning, spike in 1 µL ClaI to the tube and continue incubating at 37ºC for several more hours. -- from 9:30 am to 4:00 pm on 8/6/21 (total 24 h).
0.7X SPRI (Ampure XP) clean up
- Pre-warm beads from 4ºC to room temperature.
- Add 70 µL SPRI to the tube, pipette to mix, and incubate for 10 min.
- Wash with 150 µL 70% ethanol twice.
- Remove ethanol and air dry for 10 min.
- Add 80 µL water and heat 37°C for 10 min.
- Put on magnet and transfer eluate (80 µL) to a new tube.
- Nanodrop the sample.
- Run 20 ng cleaned product on a gel. Expected band sizes as below.
- Store at -20°C.
PCR1: Amplify Subpools From Array
If pool was not ordered as several subpools, jump to C (“PCR2”).
Note: For long PCR products and more complex designs (e.g. prime editing gRNAs), you may need to extend the PCR extension time to 1-2 minutes during PCR1 and PCR2 to reduce intramolecular PCR recombination (e.g., between the spacer and extension sequences for pegRNAs).
Preparation of primers
- User/order subpool primers from IDT (Subpool_PCR1_primers plate). This will be a common use primer plate and thus has more primers than needed in the current experiment.
- Several plate replicates in -20C linear space freezer as of 1/30/23.
Preparation of oligo pool solution
- Oligo pool from Agilent: 10 pmol of linear, unamplified, pooled oligos.
- Dissolve this in water to make 10 ng/µL stock solution.
- Dilute to make an aliquot of 1 ng/µL pool: 2 µL + 18 µL water.
PCR1
- Make PCR mix for library
| µL per reaction | ||
| 2× NEBNext Master Mix | 30 µL | |
| Fwd Primer (10 µM) | 3 µL | |
| Rev Primer (10 µM) | 3 µL | |
| Diluted Oligo Pool (1 ng/µL) (10 ng) | 10 µL | |
| H2O | 14 µL | |
| Total | 60 µL |
- Thermocycler:
| 98°C | 30 Sec | ||
| 98°C | 15 sec | 20 cycles | |
| 62°C | 15 sec | ||
| 72°C | 15 sec | ||
| 72°C | 120 sec | ||
| 4°C |
1X SPRI (Ampure XP) clean up
- Pre-warm beads from 4ºC to room temperature.
- Add 60 µL or 25µl SPRI to the tube, pipette to mix, and incubate for 2 min.
- Wash with 150 µL 70% ethanol twice.
- Remove ethanol and air dry for 5-10 min.
- Add 50 µL water and let DNA elute for 2 min.
- Put on magnet and transfer eluate to a new tube.
- Run 5 µL cleaned product on a gel. Expected band size = 115 bp.
- Qubit the sample.
- Run gel for PCR1
- Store samples at -20°C #1 (box “EC Enhancer Screen”). Proceed to PCR2.
Qubit measurement
| Lane | Sample | Concentration | DNA amount on gel | Sample Vol | H2O | |
| M | 1 kB+ NEB | - | - | 1 µl | 14 µl | |
| 1 | Library | ng/µl | ng | 10 µl | 5 µl |
NOTE: May need to optimize PCR to obtain a strong, clean band. Ideally want to do >15-20 cycles of PCR — if overamplifying, then reduce the amount of input material rather than decreasing the number of cycles. This is because if there are subpools on the array, we want to make sure to sufficiently enrich each one of them. This recommendaton depends on how many subpools are in the array, and the relative proportions of each. See the following document for an example of PCR optimization Optimizing/Overamplified Subpool PCRs ]
PCR2: Add Gibson Arms to Subpool
If pool was not ordered as several subpools, start here using 2 ng raw pool in place of PCR1 product.
*NB: two different annealing temperatures are used here: we do a few cycles to allow the 3’ end of the primer which is specific to the template to anneal and then raise the Tm and do a further 16 cycles to amplify the product.
**Determine the number of cycles after you have done the PCR1 and nano-dropped the sample. Jesse’s guess is that 1 ng of PCR1 will go into PCR2 reaction. 10 cycles will give us 1000 ng (educated guess).
Use appropriate primers for PCR2 depending on the vector
- Crop-Opti: oRZ37 + oRZ38
- sgOpti-CS: oRZ37 + PCR2_DC_Rev
Primers
oRZ37 = GuideAmp-Fwd: GGCTTTATATATCTTGTGGAAAGGACGAAACACCG
oRZ38 = GuideAmp-Rev: CTTATTTAAACTTGCTATGCTGTTTCCAGCATAGCTCTTAAAC
PCR2_DC_Rev = GuideAmp-Rev: CTAGCCTTATTTAAACTTGCTATGCTGTTTCCAGCTTAGCTCTTAAAC
- Make PCR mix for library
Set up 3x 50ul reactions and a “NO template” negative control.
50ul reaction
| Reagent | Volume | |
| Water | 30.5 µL | |
| 5x Phusion HF Buffer | 10 µL | |
| DMSO (100%) | 1.5 µL | |
| dNTPs (10 mM) | 1 µL | |
| Primer For (10 µM) | 2.5 µL | |
| Primer Rev (10 µM) | 2.5 µL | |
| Template (0.05 pM/µL) | 1 µL | |
| HF Phusion | 1 µL |
- Thermocycler:
| 98°C | 30 Sec | ||
| 98°C | 15 sec | 4 cycles | |
| 62°C | 15 sec | ||
| 72°C | 15 sec | ||
| 98°C | 10 sec | 16 cycles | |
| 72°C | 15 sec | ||
| 72°C | 5 sec | ||
| 72°C | 120 sec | ||
| +4°C |
- Clean PCR2 with 1.5X SPRI (90µl). Elute in 30 µl water.
- Run gel. Expected band size = 103 bp for Enhancer Screen.
- Nanodrop. Concentrations of PCR2 products:
| Lane | Sample | Concentration | |
| 1 | Library | ng/µl |
Run gel to confirm band
Gibson Assemble and Transform Final Library
Be sure to include a backbone only control!!!
Gibson assembly notes:
● Joining multiple DNA fragments in a single isothermal reaction = single dsDNA molecule
● Reaction in a single tube
● Requires three enzymes: T5 exonuclease (chews back DNA from 5’ end), DNA polymerase, DNA ligase
● Using PCR, we add 20-40 bp complementary overlaps to the two DNA fragments (Gibson ends)
- Incubate for 1 hour at 50°C
- Exonuclease starts chewing fragments from 5’ to 3’ end on fragment A and fragment B
- Complementary strands anneal of fragment A and B
- DNA polymerase fills in the gaps
- DNA ligase seals the remaining nicks
- Fully sealed dsDNA
- Make Gibson assembly mix for DA sample.
| per reaction | Neg | ||
| NEB Gibson Assembly 2X Master Mix | 18.6 µL | 18.6 µL | |
| Digested backbone (X ng/µL) | 500 ng / X ng/µL (sample) | 500 ng / X ng/µL (sample) | |
| PCR2 product (Y ng/µL) | 70 ng / Y ng/µL (Sample) | - | |
| water | 70 ng / Y ng/µL (H2O) | ||
| Total | 37.2 µL | 37.2 µL |
Incubate for 1 hour at 50°C.
Purify assembled plasmid with 0.7X SPRI (Ampure XP)
- Pre-warm beads from 4ºC to room temperature.
- Add 28 µL SPRI to the tube, pipette to mix, and incubate for 10 min.
- Wash with 150 µL 70% ethanol x 3.
- Remove ethanol and air dry for 10 min.
- Add 15 µL water and heat 37°C for 10 min.
- Put on magnet and transfer eluate to a new tube.
- Store at -20°C.
Electroporation
- Electroporate 12 uL into Lucigen Endura Competent Cells.
○ cleaned Gibson product into Lucigen Endura ElectroCompetent Cells Transformation of high-complexity libraries
i. using the BioRad Xcell Electroporator
ii. 10µF, 600 Ohms, 1800 volts, exponential wave
○ Transfer to 1 mL LB recovery media (no antibiotic) and grow for 1 hour at 30°C
Expand bacteria + estimate transformed colonies
- Take 10 µL (1% of total) to estimate the number of transformed colonies by plating a serial dilution of transformation mixture [Do this for both the backbone-only control, and the desired pool]
○ After the 1 hour outgrowth in recovery media, take 10µL (1% of electroporation)
○ Dilute into 90µL LB in a 96-well plate. Continue for 6 dilutions (i.e. 1:1K, 1:10K, 1:100K, 1:1M, 1:10M, 1:100M from electroporation)
○ Streak 10µL from each dilution on a Carb plate
○ Grow overnight
○ Quantify coverage by counting a dilution with distinguishable colonies and multiplying by that dilution value (e.g. 20 colonies in the 1:100K dilution means the full electroporation has 2M colonies. In general, aiming for >1000(?)-fold coverage of the library)
○ Quantify background by counting a dilution of the backbone-only-control with distinguishable colonies and multiplying by that dilution value (e.g. 15 colonies in the 1:10K dilution means the full electroporation has 150K empty colonies)
- In parallel, from the rest of the 1mL culture (in recovery media), innoculate a 50mL LB+Carb for midiprep, and grow for 18h at 30ºC
Midiprep [Next day]:
- Take 4 mL / 50 mL out of midi and spin down for miniprep, and spin the rest for a midiprep with Monarch kit
- Do the miniprep
- [Optional: Can spin down and freeze the Midiprep pellet, and do the midiprep later]
- Do the midiprep with Qiagen EndoFree Midi Kit. Can freeze pellets for up to one week at -20ºC or one month at -80ºC.
Test miniprep with BsmBI:
- Digest
(Add enzyme last)
| µL per reaction | ||
| NEB Buffer 3.1 | 2µL | |
| 500ng plasmid | 2.7 µL | |
| BsmBI-v2 | 0.5µL | |
| water | 14.8 uL | |
| total | 20µL |
- 55ºC incubation for 1+ h
- verify on gel that no undigested vector exists
Sequence validate pool (Can use miniprep)
- Make PCR mix
- Reverse primer by backbone
- Crop-Opti: Seq998X_sgPuroSeqPrimers_Rev96.xlsx
- sgOpti-CS: Seq998-series CS Rev (10 µM)
| µL per reaction | MM for _3.3x__ reactions | ||
| 2× Q5 Hot Start Master Mix | 25µL | 82.5 | |
| Seq997-series Fwd (10 µM) | 2.5µL | - | |
| Reverse Primer (10µM) | 2.5µL | - | |
| Diluted Pool (1 ng/uL) | 1µL | - | |
| H2O | 19µL | 62.7 | |
| total | 50µL |
- thermocycler:
| 98°C | 30 Sec | ||
| 98°C | 15 sec | 4 cycles | |
| 64°C | 15 sec | ||
| 72°C | 16 sec | ||
| 98°C | 15 sec | 16cycles | |
| 72°C | 5 sec | ||
| 72°C | 15 sec | ||
| 72°C | 120 sec | ||
| +4°C |
- check on 2% gel about expected PCR product: 215 bp
- clean with 1X SPRI beads, elute in 40µL H2O
- clean again with 1X SPRI beads, elute in 20µL H2O
- measure library concentration with Qubit
- check on 2% gel to confirm primer gone
- pool samples together
MiSeq Sequencing
- Load custom primers (600µL of 0.5µM primer diluted in HT1 buffer):
● into Port 18 (Custom Read 1):
○ Crop-Opti or sgOpti-CS backbone: Seq999_hU6_R1
○ Direct capture backbone: PCR2_DC_Fw
● into Port 19 (Custom Index Primer)
○ Crop-Opti: Seq996_sgPuro_I
○ sgOpti-CS: CS_I1_Updated_Seq_Primer
HCASMC virus transduction and MOI titration
Goal
- Pacakging lentivirus in HEK293 cell line
- Confirm MOI
- Transduce HCASMC
Pacakging lentivirus in HEK293 cell line
- For lentivirus packaging and envelope plasmids, we use pMD2.G and pCMV-dR8.91.
- HEK cells are split the night before at 5million per 10cm dish to allow for 80-90% confluency.
- 24 hours after seeding, cells are transfected using lipofectamine 3000.
- Plasmid ratio should be roughly 1: 0.25 : 1 molar ratio of pCMV-dR8.91 12150bp : pMD2G 5824bp, GOI viral plasmid
- Change media to fresh media without virus at the end of the day (or overnight)
- 48 hours after transfection, collect viral supernatant, filter viral supernatant with 0.45um filter syringe
- Aliquots are frozen at -80C, no freeze-thaws are used
Confirm MOI
- To estimate viral titers for our Crop-GFP vector, HCASM are grown on 6 well plates
- Virus is thawed and added to cell media with polybrene (final 8 ug/ml)
- Remove viral supernatant after 5-7 hrs
- MOI (low titer) is estimated by FACS sorting to estimate total transduction rat
Transduce HCASMC
- Culture HCASMC in a 10 cm dish at approximately 200K–500K cells per dish before transduction.
- Incubate overnight.
- The virus is thawed and introduced into the cell media containing polybrene at a final concentration of 8 µg/ml.
- HCASMC are transduced using an estimated MOI of 0.1–0.2.
- Discard the viral supernatant after 5 to 7 hours.
- Incubate for 7 days before harvesting to promote the SMC phenotype transition.
Harvesting and fixation of hTerT-HSCASMs w/Cas9 cells
Check cell
GFP expression for CRISPRi expression and scatter plot distribution for cell viability using flow cytometry. Take pictures of cells with and without GFP and TdTomato
Harvest cells
Prepare cells in a 15 ml tube.
Centrifuge cells at 200g for 3 min at RT.
Remove supernatant without disrupting the cell pellet. Count cells!
Using a wide-bore pipette tip, add 1 ml PBS with 0.04% BSA to the tube. Gently pipette mix 5 times to resuspend the cell pellet.
Centrifuge cells at 200g for 3 min.
Remove supernatant without disrupting the cell pellet.
Add 400-500 µl (target 7-8million/ml) of PBS with 0.04% BSA to achieve the target cell concentration. Gently pipette mix 10 – 15 times or until the cells are completely suspended.
Wet the FACS tube Flowmi with PBS
Use a 40 µm Flowmi‱ Tip Strainer (FACS tube strainer) to remove any remaining cell debris and large clumps. FACS sorting at FACS core, Sort into 2ml low bind tubes.
After coming from FACS, spin down 500g x5 mins, resuspend in 1000 ul, check viability with Countess and manually count cells (countess 10ul of cell suspension, 10 ul of trypan blue)
Spin down 500g x 5 mins
Make cell suspension (based on manual cell counting) of the sample such that the cell concentration is (1000) 1100-1300 cells/µl.
Place the cells on ice and immediately proceed to the next fixation step
EvercodeTM Cell Fixation v2
Block Tubes with BSA
Although not required, blocking centrifuge tubes with BSA can increase cell retention. This is
especially helpful for cells prone to aggregation or when working with low cell counts.
To block tubes:
1. Prepare a fresh 1% BSA as follows, depending on the number of samples processed.
1% BSA
- For each sample, fill two 15 mL polypropylene centrifuge tubes with 15 mL of 1% BSA
and cap the tubes.
-Invert once to fully coat the tubes.
-Incubate the tubes for 30 minutes at room temperature.
-Decant and discard the 1% BSA. Remove any remaining solution from the bottom of the
-tube with a P1000.
-With the caps removed, air dry the tubes for 30 minutes in a biosafety cabinet at room
-temperature.
-Proceed to the fixation protocol in Section 1.2 or store BSA-coated tubes at 4°C for up
to 4 weeks.
Cell Fixation
After the initial centrifugation to remove the buffer/medium from the single cell suspension,
cells are transferred to Cell Prefixation Buffer. Reagents are added to fix and permeabilize the
cells, which are then neutralized. Samples are either processed immediately, or DMSO is added
prior to freezing at -80°C.
-Cool the centrifuge with a swinging bucket rotor to 4°C.
Fill a bucket with ice.
-Prepare a hemocytometer, flow cytometer, or other cell counting device.
-If the samples will not be barcoded immediately after fixation, place a Mr. Frosty
-Freezing Container (or equivalent) at room temperature.
-Count the cells in the single cell suspension with a hemocytometer or alternative
counting device and record the count. Keep cells on ice during counting and work quickly
to minimize time on ice prior to fixation.
-If the sample has less than 1 million cells or is prone to aggregation (such as PBMCs), we
recommend preparing Cell Prefixation Buffer + BSA as described below. Mix thoroughly
by pipetting 5x and store on ice. This mix should be prepared fresh and used the same
day.
| Number of Samples | 1 | 2 | 3 | 4 | |
| ● Cell Prefixation Buffer | 750 μL | 1.5 mL | 2.25 mL | 3.0 mL | |
| Gibco Bovine Albumin Fraction V (7.5% solution) | 50 μL | 100 μL | 150 μL | 200 μL | |
| Total Volume | 800 μL | 1.6 mL | 2.4 mL | 3.2 mL |
-Transfer 100,000 to 4 million cells into a 15 mL polypropylene centrifuge tube (or BSA-
coated polypropylene centrifuge tube).
-Centrifuge the 15 mL tube in a swinging bucket rotor for 5-10 minutes at 200-600 x g
at 4°C.
- Remove and discard the supernatant. Fully resuspend the pellet in 750 μL of cold Cell
Prefixation Buffer (or Cell Prefixation Buffer + BSA, if prepared in step 7) with a P1000
set to 750 μL.
- Pipette cells through a cell strainer with an appropriately sized mesh into a new 15 mL
tube (or BSA-coated 15 mL tube) with a P1000 and store on ice.
- Add 250 μL of Cell Fixation Solution to the 15 mL tube and mix immediately by
pipetting exactly 3x with a P1000 set to 250 μL.
- Incubate on ice for 10 minutes.
- Add 80 μL of Cell Permeabilization Solution to the 15 mL tube and mix thoroughly by
pipetting 3x with a P1000 set to 250 μL.
- Incubate on ice for 3 minutes.
- Mix the Cell Neutralization Buffer by inverting the tube 5x. Do not vortex.
- Add 1 mL of P1000 set to 1000 μL Cell Neutralization Buffer to the 15 mL tubes. Gently pipette 3x with a
- Centrifuge the 15 mL tube in a swinging bucket rotor for 5-10 minutes at 200-600 x g
at 4°C.
- Remove and discard the supernatant. Fully resuspend each pellet in 150 μL cold Buffer with a P1000 set to 150 μL and store on ice.
- Pipette cells through a cell strainer with an appropriately sized mesh into a new 1.5 mL
tube with a P1000 and store on ice.
- Count the number of cells in the sample with a hemocytometer or alternative counting
device and record the count. Keep cells on ice during counting and work quickly to
minimize the time that fixed cells are out.
- Proceed to the appropriate user guide if immediately processing samples with an
Evercode Whole Transcriptome kit. Otherwise, proceed to the next step.
- Add 2.5 μL of DMSO. Gently flick the tube 3x to mix.
- Incubate on ice for 1 minute.
- Repeat steps 22 and 23 twice for a total addition of 7.5 μL of DMSO.
- Gently mix by pipetting up and down 5x with a P200 set to 75 μL. Avoid creating
bubbles.
- Store tubes in a Mr. Frosty Freezing Container (or equivalent) at -80°C, according to
the manufacturer’s instructions.