Dec 08, 2025
Version 2
HBV Whole-Genome Sequencing using Oxford Nanopore MinION V.2
- Joakim Bedner Stenbäck1,
- Johan Ringlander1
- 1University of Gothenburg
External link: https://doi.org/10.1002/jmv.70630
Protocol Citation: Joakim Bedner Stenbäck, Johan Ringlander 2025. HBV Whole-Genome Sequencing using Oxford Nanopore MinION. protocols.io https://dx.doi.org/10.17504/protocols.io.n92ldrow9g5b/v2Version created by Joakim Bedner Stenbäck
Manuscript citation:
Stenbäck JB, Schmidt D, Noborg U, Gustafsson J, Norberg P, Andersson ME, Fu MX, Harvala H, Ringlander J (2025) Accurate and Cost‐Efficient Whole Genome Sequencing of Hepatitis B Virus Using Nanopore. Journal of Medical Virology 97(10). doi: 10.1002/jmv.70630
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: December 08, 2025
Last Modified: December 08, 2025
Protocol Integer ID: 234450
Keywords: HBV, Sequencing, Nanopore, Whole Genome, Genotyping, using oxford nanopore minion, oxford nanopore minion this protocol, oxford nanopore minion with flongle flowcell, hbv whole, hbv, sequencing kit, genome sequencing, genome, whole genome, sequencing
Abstract
This protocol outlines the steps for preparing and sequencing the hepatitis B virus (HBV) whole genome using Oxford Nanopore MinION with Flongle flowcells. It details primer-based amplification, quality control using Agilent TapeStation, and library preparation using the Oxford Nanopore RBK114.24 or RBK114.96 barcoding sequencing kit.
Materials
Reagents
- 2X Platinum Polymerase
- Primers (10 µM):
- Forwards: 56F, 1689F
- Reverses: 1827R, 262R
- Nested (if required): 251F, 1801 R
- Nuclease-free water (SuperQ water)
- DNA Sample
- Agilent TapeStation D5000 Screentape Kit (or equivalent such as Gel Electrophoresis)
- Oxford Nanopore RBK114.24 or RBK114.96 Barcoding Sequencing Kit
Equipment:
- PCR Thermal Cycler
- Agilent TapeStation
- Oxford Nanopore MinION with Flongle Flowcells
Step 1: Requirements and Master Mix Preparation
30m
Reagent Requirements:
- ThermoFisher Platinum Hot Start PCR Master Mix (2X) (Cat. 13000014)
- System 1 Forward Primer 56F at 10 μM (CCTGCTGGTGGCTCCAGT)
- System 1 Reverse Primer 1827R at 10 μM (GAAAAAGTTGCATGGTGCTGGT)
- System 2 Forward Primer 1689F at 10 μM (ACCGACCTTGAGGCCTACTTCA)
- System 2 Reverse Primer 262R at 10 μM (CCACCACGAGTCTAGACTCT)
- Nesting System 1 Forward Primer 251F at 10 μM (GTGGTGGACTTCTCTCAATTTTC)
- Nesting System 1 Reverse Primer 1801R at 10 μM (CAGACCAATTTATGCCTACAGCCT)
Hardware Requirements:
- Thermocycler
- Agilent Tapestation System (optional)
- Agilent D5000 Screentape (Cat. 5067-5589.) (optional)
Prepare two separate master mixes for the two primer systems:
- ThermoFisher Platinum Hot Start PCR Master Mix (2X) 15 µL
- Forward Primer (56F or 1689F) at 10 μM 1 µL
- Reverse Primer (1827R or 262R) at 10 μM 1 µL
- Nuclease-free water 8 µL
- DNA sample 5 µL
- Total Volume: 30 µL
30m
Step 2: PCR Amplification
3h
Run both master mixes in single PCR reactions under the following cycling conditions:
| Step | Cycles | Temperature (°C) | Time | |
| Initial Denaturation | 1 | 95°C | 2:00 | |
| Denaturation | 40 | 95°C | 0:45 | |
| Annealing | 40 | 58°C | 1:00 | |
| Extension | 40 | 72°C | 3:00 | |
| Final Extension | 1 | 72°C | 3:00 | |
| Storage | 1 | 4°C | ∞ |
Nesting PCR settings if required as listed in Step 3:
Utilize primers 251F and 1801R fitted for system 1.
| Step | Cycles | Temperature (°C) | Time | |
| Initial Denaturation | 1 | 95°C | 2:00 | |
| Denaturation | 20 | 95°C | 0:45 | |
| Annealing | 20 | 58°C | 1:00 | |
| Extension | 20 | 72°C | 3:00 | |
| Final Extension | 1 | 72°C | 3:00 | |
| Storage | 1 | 4°C | ∞ |
Step 3: Quality Control
1h
Run amplified products on Agilent TapeStation using the D5000 Screentape kit according to the manufacturer’s instructions.
The expected product size for system 1 and 2 is ~1800bp.
If bands are detected, proceed to Step 4, otherwise proceed to Step 3.1.
- If no band is detected for system 1, perform a nested PCR using primers 251F and 1801R.
- Repeat TapeStation analysis to confirm amplification.
Step 4: Library Preparation and Sequencing
2h
- If bands are visible, pool the systems for each sample and proceed with library preparation using the Oxford Nanopore RBK114.24 or RBK114.96 kit according to the manufacturer’s protocol. Samples that drastically differ in concentration are normalised to ensure even distribution across the flow cell array.
- Load the prepared library onto the Oxford Nanopore MinION with Flongle flowcells alternatively the Nanpore MinION with standard flow cells and initiate sequencing with the desired run settings.
Step 5: Bioinformatic analysis
After sequencing, an array of varied analyses are possible.
For genotyping and resistance mutation identification it is recommended to establish a consensus sequence from the data by utilising the Oxford Nanopore Technologies tool Medaka. This pipeline will polish the reads and further reduce any present error rate. Prior to Medaka, mapping can be done with software like Minimap2 to ensure high quality mapping of long reads, Samtools for file conversion followed by the Medaka consensus function.
The approach used in our study for clinical application is available on GitHub: https://github.com/ClinicalGenomicsGBG/hbv_nano/tree/hbv_nano_daniel