Oct 12, 2025
Guide Cloning
- Nahum Smith1
- 1University of Washington
Protocol Citation: Nahum Smith 2025. Guide Cloning. protocols.io https://dx.doi.org/10.17504/protocols.io.3byl46ddjgo5/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: October 11, 2025
Last Modified: October 12, 2025
Protocol Integer ID: 229589
Keywords: guide cloning this protocol detail, guide cloning, cloning, protocol detail, protocol
Abstract
This protocol details guide cloning.
Materials
1. T4 DNA Ligase Buffer
2. T4 Polynucleotide Kinase (PNK)
3. Water
4. Oligos
5. BbsI-HF
6. PX45-sfGFP (50-100 ng/uL)
Troubleshooting
Phosphoannealing Oligo Duplexes
1h
Thaw deep well plates of paired oligos in a centrifuge pre-cooled at 4C at 500g for 20 minutes.
If oligos are in separate tubes, pair Watson (W) and Crick (C) oligo tubes.
| A | B | C | |
| Reagent | 1X (10 uL reaction) | 100X (for full 96-well plate) | |
| T4 DNA Ligase Buffer | 1uL | 100 uL | |
| T4 Polynucleotide Kinase (PNK) | 0.5 uL | 50 uL | |
| Water | 6.5 uL | 650 uL | |
| Subtotal | 8 uL | 800 uL | |
| Oligos | 1uL of each oligo 2uL if paired in well | X |
Prepare phosphoannealing master mix on ice
Thaw T4 ligase buffer on ice
Do not use T4 PNK Buffer, use T4 Ligase buffer
Do not use T4 Ligase enzyme, use T4 PNK
Keep T4 PNK at -20C in a cool block
Add buffer first, then enzyme, then mix with water volume
Dispense 8 uL of mix to each well of a 96-well plate or sets of 8-strip tubes
Transfer 2 uL of 100uM paired oligos into each well, or 1 uL each of 100uM oligos from individual W and C tubes
Seal with foil seal and briefly spin down
Use Phosphoannealing Oligos protocol on Eppendorf thermal cyclers
| A | B | C | |
| 37C 30min | 95C 5min | Ramp to 25C, -5C per min |
1h
Dilute 1 uL of phosphoannealing reaction into 199 uL water in a new 96-well plate, mixing thoroughly
Goldengate Diluted Oligo Duplexes into PX45-sfGFP
Prepare Goldengate master mix on ice
| A | B | C | |
| Reagent | 1X (10 uL reaction) | 100X | |
| T4 DNA Ligase Buffer | 1 uL | 100 uL | |
| T4 DNA Ligase | 0.5 uL | 50 uL | |
| BbsI-HF | 0.5 uL | 50 uL | |
| PX45-sfGFP | |||
| (50-100 ng/uL) | 1 uL | 100 uL | |
| Water | 6 uL | 600 uL | |
| Subtotal | 9 uL | 900 uL | |
| 1:200 diluted oligos | 1 uL | X |
Thaw T4 ligase buffer on ice
Do not use T4 PNK enzyme, use T4 Ligase enzyme
Keep T4 ligase and BbsI-HF at -20C in a cool block
Add buffer first, then enzymes, then plasmid, then mix with water volume
Dispense 9 uL of Goldengate master mix to a new 96-well plate
Transfer 1 uL of diluted oligo duplexes to each well and mix thoroughly
Seal with foil seal and briefly spin down
Use BbsI T4lig GG protocol on Eppendorf thermal cyclers
| A | B | C | D | E | |
| 50X | 1X | 1X | Hold | ||
| 37 C (cut) | 16 C (ligate) | 50 C (extra cut) | 80 C (inactivate) | 10 C | |
| 1:00 min | 1:00 min | 30:00 min | 5:00 min | Hold | |
37 C (cut) for 1:00 min, 16 C (ligate) for 1:00 min, 50 C (extra cut) for 30:00 min, 80 C (inactivate) for 5:00 min, then hold at 10 C.
Transformation of Stellar Competent E. coli
Thaw [# of samples / 10] vials of Stellar Competent E. Coli on ice for 10 minutes
1 vial contains slightly over 100 uL of cells
Preheat thermal cycler to 42 C
Preheat LB + Amp agar plates in 37 C incubator
Preheat LB to 37 C (optional)
Dispense 10 uL of cells to each well of a new 96-well plate
Transfer 1 uL of each goldengate mix to each well of cells
Do not mix by pipetting, but ensure that the mix has been added to the middle of the cells, gently tap the side of the plate to mix
Seal with fold seal, do not spin down
Incubate cells on ice for additional 5 minutes
Heat-shock plate on thermal cycler with lid-open for 30 seconds
Incubate cells on ice for additional 2 minutes
Add 40 uL LB (20-37 C) to each well and mix
Add 45 uL LB to 2 new 96-well plates
Transfer 5 uL LB + Cells to dilution plate 1 and mix
Transfer 5 uL diluted LB + Cells from dilution plate 1 to dilution plate 2 and mix
Plate 5 uL of each well from dilution plate 2 on a new rectangular agar plate, or plate 50 uL on separate 10 cm agar plates
Allow rectangular agar plate to dry underneath open flame until liquid has absorbed into agar
Glass beads can spread media on 10 cm agar plates with no need for drying
Plate 2 uL of each well from dilution plate 2 on a second new rectangular agar plate
Grow overnight in 37 C incubator
Colony Selection and Stock Generation
Prepare a deep well plate for overnight growth
Mix 50 mL Terrific Broth with 50 uL Carbenicillin
Dispense 500 uL to each well of a new deep-well plate
Place agar plate with appropriate cell density on blue light block
Use pipette tip to pick non-GFP colonies from plate
Drop tip in corresponding well of media-filled deep-well plate
Colonies can also be picked and dropped immediately into 60 mL of Terrific Broth + 60 uL of Carbenicillin for overnight incubation if a Maxi-Prep is intended the following day.
Grow overnight at 37 C
The following day, prepare glycerol stocks
Mix 500uL of 50% glycerol in water with each well in deep well plate
Freeze glycerol stocks at -80 C. Glycerol stocks can be scraped with a pipette tip and dropped into 60 mL of Terrific Broth + 60 uL of Carbenicillin for overnight growth.
Plasmid Preparation and Sequence Verification
Centrifuge 50 mL of overnight growth at 3000 - 4000 rc f for 20 - 30 minutes
Media should be clear and pellet should be large at bottom of conical tube
Perform Zymo Maxi-Prep according to the manufacturer protocol
Elute with 400 uL 50 C water, not elution buffer
Proceed with endotoxin removal
Quant Plasmid Prep with Qubit Broad Range kit
Send approx 200 ng in 10 uL volume + 5 uL 5 uM U6 primer (5' GACTATCATATGCTTACCGT 3') to Genewiz (or equivalent Sanger sequencing service) for sequence verification
Store the prepared plasmid in the ‘awaiting confirmation’ sgRNA box.
The next day, upload sequences to Benchling
Use Benchling “Attach Primers” feature to automatically tag Watson strand sgRNA oligo sequences.
If the Sanger trace is poor quality, resequence
If there are visible BbsI cut sites in the sequence, dispose of the plasmid immediately
If there are no visible BbsI cut sites in the sequence, but the sequence has not been autotagged by the Attach Primers feature, please confirm the sequence by looking at other documents and spreadsheets and create a new Primer or Annotation for the correct guide sequence.
Only print a detailed label that references target and concentration if
Sequence confirmed
Acceptable concentration for transfection (typically 3e500 ng / uL)