Jan 12, 2022
Version 3
Genotyping Arabidopsis T-DNA lines V.3
- 1Realizing Increased Photosynthetic Efficiency (RIPE);
- 2University of Illinois at Urbana-Champaign
- GEGC lab UIUC
Protocol Citation: Lynn Doran, Steven J Burgess 2022. Genotyping Arabidopsis T-DNA lines. protocols.io https://dx.doi.org/10.17504/protocols.io.b2hzqb76Version created by Lynn Doran
Manuscript citation:
DOI: 10.1126/science.1086391
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it’s working
Created: December 01, 2021
Last Modified: July 11, 2023
Protocol Integer ID: 55577
Keywords: Arabidopsis, Genotyping
Funders Acknowledgements:
Realizing Increased Photosynthetic Efficiency (RIPE) that is funded by the Bill & Melinda Gates Foundation, Foundation for Food and Agriculture Research, and the U.K. Foreign, Commonwealth & Development Office
Grant ID: OPP1172157
Abstract
This protocol is used for genotyping Arabidopsis seedlings to test for the presence of a transfer DNA (T-DNA) insertion. By using two primer sets it is possible to determine whether a seedling is homozygous, heterozygous or azygous for an insertion in the predicted genomic location.
To identify lines with T-DNA insertions in a gene of interest, you need the Arabidopsis Genome Identifier (AGI) number corresponding to the genomic locus (e.g. RCS1A = AT1G67090), then visit the Salk Institute T-DNA Express site to find all the mapped insertions at your locus of interest.
Genotyping primers have been pre-designed for each T-DNA line, these can be retrieved from the Salk Institute T-DNA primer site, and ordered at any supplier of DNA oligonucleotides before starting the protocol.
In the US T-DNA lines can be purchased from the Arabidopsis Biological Resource Center (ABRC) and in the UK and EU from the European Arabidopsis Stock Center (NASC).
Recommended reading
- http://signal.salk.edu/tdnaprimers.2.html
Setting up the PCR reaction
Genotyping is performed with the Phire Plant Direct PCR Mix, this includes the polymerase, nucleotides and salts necessary for amplification. We use the “dilution protocol” which involves taking a small leaf disk and homogenizing it in dilution buffer using a gel tip (see manufacturer’s instructions for more details.)
Materials
**Note: There is also a Phire Tissue Direct Kit. This kit may not be able to break down cell walls to properly release DNA.**
- Genotyping primers (SALK Border: LBb1.3 ATT TTG CCG ATT TCG GAA C, SAIL Border: Lb1 C/418-451 of pCSA110-pDAP101_T-DNAs GCCTTTTCAGAAATGGATAAATAGCCTTGCTTCC)
- Swiss Line Core Sampling Tool 0.5 mm, 0.50 mm I.D., 0.80 mm O.D. (Fisher Scientific; NC1310089) /(Electron Microscopy Sciences; 69039-05)
- 100bp ladder (New England Biolabs; N0467S)
- 10,000x SYBRTM Safe DNA stain (Thermo Fisher Scientific; S33102)
- 6x Gel Loading Dye (New England Biolabs; B7024S)
Prepare primer working solution
Prepare primer working solution
Re-suspend lyophilized primers in dH2O to a stock concentration of 100 mM. Note: primer sequences can be obtained from SALK T-DNA express if you have the T-DNA accession number (http://signal.salk.edu/tdnaprimers.2.html)
Create a 10 mM working solution of the primer by diluting 10 µL of the stock into 90 µL of DNase-free water.
Preparing the PCR template
Preparing the PCR template
Using a 0.5 mm sampling device take a single leaf punch and add to 20 µL of Phire dilution buffer.
Note
Phire Plant Direct to PCR Kit is very sensitive. Sampling devices should be thoroughly sterilized in 70% Ethanol between samples to avoid cross-contamination.
Mash the sample with the end of a pipette tip or toothpick until the dilution buffer turns green.
Incubate sample at room temperature for 5 mins
Spin down sample for 1 min max speed in a mini centrifuge
Setting up the PCR reaction
Setting up the PCR reaction
Add the following components to a PCR tube. Set up one reaction with the diluted template from the putative T-DNA insertion line and one with WT arabidopsis as a negative control. The reaction will result in amplification if the T-DNA insert is present.
| A | B | |
| Component | Amount | |
| 2x Phire Master Mix | 10 µL | |
| Diluted template | 0.5 µL | |
| LBb1.3 primer [10 mM] | 1 µL | |
| RP [10 mM] | 1 µL | |
| dH2O | 7.5 µL |
- Note: LBb1.3 (ATTTTGCCGATTTCGGAAC) is the recommended sequencing primer for SALK lines. If you have SAIL, Wisc_Lox or GABI-KAT lines you will need to use a different border primer. Results have successfully been obtained for SAIL lines using SAIL Border: Lb1 C/418-451 of pCSA110-pDAP101_T-DNAs (GCCTTTTCAGAAATGGATAAATAGCCTTGCTTCC)
In a second PCR tube set up the following reaction. Set up one reaction for the putative T-DNA insertion line and one for WT arabidopsis as a positive control. This reaction tests for the absence of a TDNA insertion. If a T-DNA insertion is present there will be no amplification product as the distance between the L and R primers. The WT control should give a product, and heterozygous lines will also give a product as there is one WT allele.
| A | B | |
| Component | Amount | |
| 2x Phire Master Mix | 10 µL | |
| Diluted template | 0.5 µL | |
| LP [10 mM] | 1 µL | |
| RP [10 mM] | 1 µL | |
| dH2O | 7.5 µL |
Run the following PCR program
| A | B | C | D | |
| Step | Temperature | Time | Cycles | |
| Initial denaturation | 98 | 5 min | 1 | |
| Denaturation | 98 | 5s | 40 | |
| Annealing | * | 5s | ||
| Extension | 72 | 20s | ||
| Final Extension | 72 | 1 min | 1 |
*indicates annealing temperature to be adjusted to primer
Note
Primers obtained from Salk Institute TDNA Site come with a recommended annealing temperature. Be aware that the annealing temperature will be different when using Phire taq polymerase. Recommended annealing temperature for primers when using Phire taq polymerase can be calculated using Thermo Fisher's Tm Calculator.
Optimization of annealing temperature may still need to be conducted experimentally.
Analyze the resulting products by gel electrophoresis