Jan 10, 2026
Generation of SLC45A1 Knockout iPSC Line (WTC11-Ngn2 Line)
- Marc Gastou1,
- Ali Ghoochani2,3,4,5,
- Natalia Gomez-Ospina1,
- Monther Abu-Remaileh2,3,4,5
- 1Department of Pediatrics, Stanford University School of Medicine, Stanford, CA, 94305, USA;
- 2Department of Chemical Engineering, Stanford University, Stanford, CA 94305, USA;
- 3Department of Genetics, Stanford University, Stanford, CA 94305, USA;
- 4The Institute for Chemistry, Engineering and Medicine for Human Health (Sarafan ChEM-H), Stanford University, Stanford, CA 94305, USA;
- 5Aligning Science Across Parkinson’s (ASAP) Collaborative Research Network, Chevy Chase, MD, 20815, USA
- asap
Protocol Citation: Marc Gastou, Ali Ghoochani, Natalia Gomez-Ospina, Monther Abu-Remaileh 2026. Generation of SLC45A1 Knockout iPSC Line (WTC11-Ngn2 Line). protocols.io https://dx.doi.org/10.17504/protocols.io.e6nvw45zzlmk/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: July 24, 2025
Last Modified: January 10, 2026
Protocol Integer ID: 223162
Keywords: generation of slc45a1 knockout, slc45a1 knockout, pluripotent stem cell, ipsc line, slc45a1, spcas9 system, ipsc, gene, crispr, other any gene, wtc11, ngn2 line
Abstract
This protocol describes the generation of an SLC45A1 knockout ( or other any gene) in WTC11-Ngn2 induced pluripotent stem cells (iPSCs) by targeting the coding sequence (CDS) using the CRISPR-spCas9 system.
Materials
Reagents:
• Thiazovivin (ROCK1 inhibitor), 10 µM
• ReLeSR‱ (Stemcell Technologies, for cell dissociation)
• Cas9 enzyme (IDT Alt-R S.p. Cas9 Nuclease V3), 10 µg/µL
• sgRNA (Synthego, 2'-O-methyl modified), 3.2 µg/µL
• P3 Primary Cell Nucleofector‱ Solution (Lonza, V4XP-3032)
• 16-well Nucleocuvette‱ Strips
• 4D-Nucleofector‱ System (Lonza)
• iPSC growth medium (e.g., StemFlex, Stemcell Technologies)
• Sterile PBS
• 24-well tissue culture plates
Troubleshooting
Designing the Single Guide RNA (sgRNA)
• Clone 1 sgRNA: AGATGCCCTCTTCCCCAGCG
• Clone 2 sgRNA: ACTTCAAACGACACCCCAAG
Pre-treatment of iPSCs (Day -1)
Objective: Enhance iPSC viability prior to nucleofection.
1. Plate iPSCs at ~50% confluency in iPSC growth medium.
2. Add 10 µM Thiazovivin.
3. Incubate overnight at 37 °C with 5% CO₂.
Preparation of Cas9-sgRNA RNP Complex
Assemble the Cas9-sgRNA ribonucleoprotein (RNP) complex.
In a PCR tube, mix 6 µg Cas9 protein with 3.2 µg sgRNA.
Incubate at 37 °C for 15 minutes.
Keep the RNP complex on ice until use.
Dissociation of iPSCs
Prepare a single-cell suspension for nucleofection.
Aspirate the medium and add ReLeSR‱ to the iPSCs.
Incubate at 37 °C for 3–5 minutes.
Gently tap the plate to detach cells and resuspend them in iPSC growth medium.
Count viable cells and adjust to 0.3 × 10⁶ cells per nucleofection.
Centrifuge at 300 × g for 3 minutes.
Wash the pellet with sterile PBS and centrifuge again at 300 × g for 3 minutes.
Resuspend the cell pellet in 20 µL P3 Nucleofector‱ Solution per nucleofection (16.4 μl of P3 solution was mixed with 3.6 μl of Supplement).
Post-Transfection Treatment (Day 1–3)
Facilitate iPSC recovery and expansion.
After 24 hours, replace the medium with fresh iPSC growth medium.
Continue treatment with 10 µM Thiazovivin.
Culture cells for an additional 72 hours.
Validation of SLC45A1 Knockout
Amplify the targeted genomic region via PCR.
Perform Sanger sequencing of the PCR amplicons.
Analyze chromatograms using ICE software (Synthego) to determine indel frequency and knockout efficiency by comparing edited cells to wild-type or mock-treated controls.