Oct 10, 2025
Generation of multiplex tRNA-gRNA constructs for Marchantia polymorpha CRISPR
- Eftychis Frangedakis1,2
- 1University of Cambridge;
- 2Plant Sciences
Protocol Citation: Eftychis Frangedakis 2025. Generation of multiplex tRNA-gRNA constructs for Marchantia polymorpha CRISPR. protocols.io https://dx.doi.org/10.17504/protocols.io.q26g7nx78lwz/v1
Manuscript citation:
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: September 15, 2025
Last Modified: October 10, 2025
Protocol Integer ID: 227355
Keywords: Marchantia, CRISPR, thallus transformation, tRNA, genome editing, grna constructs for marchantia polymorpha crispr, generation of multiplex trna, synthesis of multicomplex trna, grna modules by golden gate assembly, marchantia polymorpha crispr, pcr amplification of trna, multicomplex trna, multiplex trna, grna module, grna unit with the transcription unit, grna construct, mpu6 promoter, trna, marchantia polymorpha, grna fragments into an l1 vector, crispr, pgtr plasmid, grna fragment, pgtr plasmid as the template, transcription, grna unit, synthesis, pcr amplification, loop assembly, cas9, transcription unit
Abstract
This protocol describes a Marchantia polymorpha specific modification of the Xie et al 2015 protocol
(https://doi.org/10.1073/pnas.1420294112) for the synthesis of multicomplex tRNA-gRNA modules by Golden Gate Assembly/Loop Assembly. It has 3 main steps:
A. Primer design and PCR amplification of tRNA-gRNA fragments using the pGTR plasmid as the template.
B. Loop assembly cloning of the amplified tRNA-gRNA fragments into an L1 vector,
to combine them with the MpU6 promoter
C. Loop assembly cloning into the L2 pCsA acceptor vector to combine the MpU6::tRNA-gRNA unit with the transcription unit for Cas9 expression
Materials
L1_lacZgRNA-Ck2 or L1_lacZgRNA-Ck3 vectors (Addgene #136136 or Addgene
#136137).
T4 DNA ligase buffer (NEB),
1 mg/mL bovine serum albumin (NEB, #B9200S)
T4 DNA ligase 400 U/μL (NEB, #M0202S),
1.5 μL of BbsI-HF 10 U/μL (NEB, #R3539),
50 μg/mL kanamycin (MELFORD, #K22000–1.0)
40 μg/mL X-Gal
(5-bromo-4-chloro-3-indolyl-β-D-galactoside) (ThermoFisher, #15520018).
The pGTR plasmid (Addgene #63143)
Phusion polymerase (ThermoFisher, #F534S)
QIAquick Gel Extraction Kit (QIAGEN, #28704)
SapI (10 U/μL, NEB, #R0569S),
pCsA vector (Addgene #136067)
spectinomycin (MERCK, #S4014-5G)
L1 vectors: L1_Cas9-Ck4 containing the transcription unit for
the Cas9 expression, (Addgene #136135 (Sauret-Güeto
et al. 2020)); L1_CsR-Ck1 (Plasmid #136124)
or L1_HyR-Ck1 (Addgene, #136125) containing
the transcription unit for chlorsulfuron or hygromycin selection respectively; and
if necessary the L1 spacer vectors, pCk2_spacer (Addgene,
#136072) or pCk3_spacer (Addgene, #136073).
Troubleshooting
A. Primer design and amplification of tRNA-gRNA parts using the pGTR plasmid as template
The tRNA-gRNA spacer specific primers with 4 bp overlapping overhangs for BbsI
Golden Gate/Loop Assembly should have the following sequences:
BbsI enzyme recognition sequence highlighted with orange.
gRNA sequence shown with blue letters.
Overhang sequences for cloning into the acceptor vector, highlighted with red.
Sequence that is part of the gRNA scaffold or the tRNA highlighted with grey.
Primer combination is:
1 - G-primer-F & gRNA a Primer R
2 - gRNA a Primer F & gRNA b Primer R
3 - gRNA b Primer F & gRNA c Primer R
Use
the pGTR plasmid as template
B- Loop assembly cloning of tRNA-gRNA parts into the L1 vector to combine tRNA-gRNA parts with the MpU6 promoter
Plasmid concentrations should be according to (Sauret-Güeto et al. 2020). Aliquots of
the DNA part were prepared at a concentration of 15 nM and of the acceptor
vector at a concentration of 7.5 nM
To calculate the concentration in ng/μL:
- For a final concentration of 15 nM, the concentration in
[ng/μL] equals N (the length in bp of the plasmid) divided by 110. This is an
approximation of the formula:
15∙10^(-9)mol/L
x ((607.4 x N ) + 157.9)g/mol x 10^(-6)L/μL x 10^9ng/g = concentration (ng/μL)
- For a final concentration of 7.5 nM, the concentration in
[ng/μL] equals N divided by 220.
Prepare reaction master mix (in μL):
| MilliQ H2O | Up to 20 | |
| BSA (1 mg/mL) | 1.5 | |
| 10x T4 DNA Ligase buffer (NEB) | 2 | |
| T4 DNA Ligase at 400 U/μL (NEB, #M0202S) | 1.5 | |
| BbsI-HF 10 U/μL (NEB, #R3539) | 1.5 | |
| OP-074 or OP-075 plasmids | 1 | |
| tRNA-gRNA parts (Gel extracted) | 1 μL per part |
-Place samples on the thermocycler and
incubate using the following program: Loop Assembly: [3 minutes at 37oC
and 4 minutes at 16oC] x26, Termination: 5 minutes at 50oC
and 10 minutes at 80oC
-Transform chemically competent using 7-10 μL
of reaction and plate on LB agar plates with 50 μg/mL kanamycin and 40 μg/mL
X-gal. Incubate at 37oC for 16 h.
-Confirm with Sanger sequencing
C- Loop assembly cloning into the L2 pCsA acceptor to combine of tRNA-gRNA with the transcription unit for Cas9 expression
Prepare reaction master mix (in μL), plasmid concentrations
should be as above and according to (Sauret-Güeto et al. 2020):
| MilliQ H2O | Up to 20 | |
| 10x T4 DNA Ligase buffer (NEB) | 2 | |
| T4 DNA Ligase at 400 U/μL (NEB, #M0202S) | 1.5 | |
| SapI 10 U/μL (NEB, #R0569S) | 1.5 | |
| OP-074 or/and OP-075 plasmids (or appropriate pCk spacers) | 1 each | |
| Selection marker plasmid | 1 | |
| pCsA | 1 |
-Place samples on the thermocycler and
incubate using the following program: Loop Assembly: [3 minutes at 37oC
and 4 minutes at 16oC] x26, Termination: 5 minutes at 50oC
and 10 minutes at 80oC
-Transform chemically competent using 10-12 μL
of reaction and plate on LB agar plates with 100 μg/mL spectinomycin and 40
μg/mL X-gal. Incubate at 37oC for 16 h.
-Confirm with Sanger sequencing
Schematic diagram of the workflow for generating a tRNA-mediated multiplex gRNA expression construct
(A)
Top: The first primer includes a portion of the tRNA sequence along with a BbsI
recognition site and four-base overhang sequences for Loop assembly. The middle
primers contain BbsI recognition sites and four-base overlapping overhang
sequences for Loop assembly, which can correspond to any four consecutive
nucleotides (highlighted with colored rectangles) within the 20-nucleotide gRNA
sequence (shown with numbers from 1 to 20). Forward middle primers also contain
a portion of the gRNA scaffold sequence, whereas reverse middle primers contain
a portion of the tRNA sequence. The final primer includes part of the tRNA
sequence, the full reverse-complement of the last gRNA, and a BbsI recognition
site plus four-base overhang sequences for Loop assembly. Overhangs for cloning
into the acceptor vectors shown with pink letters. Bottom: The pGTR plasmid should be used as the
template for the PCR reactions. The primer combinations used for amplification
are as follows: (1) G-primer-F & gRNA a Primer R, (2) gRNA a Primer F &
gRNA b Primer R, and (3) gRNA b Primer F & gRNA c Primer R, n: any
nucleotide .
(B)
After PCR amplification and gel extraction, all fragments are combined with the
OP-074 or OP-075 vector (Sauret-Gueto et al., 2020) in a Loop Assembly/Type IIS
cloning reaction. LacZ: lacZα cassette for blue-white screening of colonies (negative blue colonies
contain undigested L1 vectors, while positive white colonies contain tRNA-gRNA parts inserted into the L1 vectors.
(C)
Finally, the tRNA-gRNA-OP-074 or OP-075 vector is combined with the OP-073
vector, which contains the MpEF1a::Cas9
transcription unit, an appropriate L1 vector for plant selection, in a Loop
Assembly/Type IIS cloning reaction.
An example
An
example:
G-primer-F
5’ AGgaagacTACTCGAACAAAGCACCAGTGG 3’
gRNA14
Forward sequence: 5’ TTGCAGCAGTGGAGAAAAGA 3’
Reverse complement sequence: 5’ TCTTTTCTCCACTGCTGCAA 3’
GLK14-a-F
5’ GAgaagacATGTGGAGAAAAGAGTTTTAGAGCTAGAA3’
GLK14-a-R
5’ GAgaagacTACCACTGCTGCAATGCACCAGCCGGGAA3’
gRNA3
Forwardsequence: 5’ GGGCGAGGGCTTCAAGATAC 3’
Reverse complement sequence: 5’ GTATCTTGAAGCCCTCGCCC 3’
GLK3-b-F
5’ GAgaagacATGCTTCAAGATACGTTTTAGAGCTAGAA3’
GLK3-b-R
5’ GAgaagacTAAAGCCCTCGCCCTGCACCAGCCGGGAA3’
gRNA7
Forward sequence: 5’ AGGATATGGAGTGGGTTGCT 3’
Reverse complement sequence: 5’ AGCAACCCACTCCATATCCT 3’
Final-c-GLK7
5’ GAgaagacTATAAAACAGCAACCCACTCCATATCCTTGCACCAGCCGGGAATC 3’
Amplify
using PCR from pGTR plasmid, Gel extract and then directly clone into L1
plasmids using BbsI GG reaction
For the PCR, use Phusion (Thermo) or a similar proofreading polymerase
PCR
cycling conditions were: 98oC (1:30), [98oC (30sec), 55oC (30sec), 72oC (45sec)] x35, 72oC (5min)
Primer combination is:
1 - G-primer-F & GLK3-b-R
2 – GLK3-a-F & GLK14-b-R
3 - GLK14-b-F & Final-c-GLK17
After cloning in the L2 acceptor the tRNA-gRNA
construct will be:
Protocol references
Sauret-Güeto S, Frangedakis E, Silvestri L, Rebmann M, Tomaselli M, Markel K, Delmans M,
West A, Patron NJ, Haseloff J. 2020. Systematic Tools for Reprogramming
Plant Gene Expression in a Simple Model, Marchantia polymorpha. ACS Synthetic Biology
Xie K, Minkenberg B, Yang Y. 2015. Boosting CRISPR/Cas9 multiplex editing capability with the endogenous tRNA-processing system. Proceedings of the National Academy of Sciences of the United States of America