May 07, 2026
Generation of DATcrePink1 Knockout Mice Expressing tdTomato in Dopaminergic Neurons
- Marie-Josée Bourque1,2,3,4,
- louis-eric.trudeau Trudeau1,5,2,3,4,6
- 1Department of pharmacology and physiology, Faculty of Medicine, Université de Montréal;
- 2Neural Signaling and Circuitry research group (SNC);
- 3Center for Interdisciplinary Research on the Brain and Learning (CIRCA);
- 4Institut Courtois d’innovation biomédicale;
- 5Department of neuroscience, Faculty of Medicine, Université de Montréal;
- 6Aligning Science Across Parkinson’s (ASAP) Collaborative Research Network, Chevy Chase, MD, 20815
Protocol Citation: Marie-Josée Bourque, louis-eric.trudeau Trudeau 2026. Generation of DATcrePink1 Knockout Mice Expressing tdTomato in Dopaminergic Neurons. protocols.io https://dx.doi.org/10.17504/protocols.io.36wgqx8kolk5/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: April 30, 2026
Last Modified: May 07, 2026
Protocol Integer ID: 316090
Keywords: generation of datcrepink1 knockout mice, generation of datcrepink1 mice, datcrepink1 knockout mice, tdtomato in dopaminergic neuron, datcrepink1 mice, dopaminergic neuron, tdtomato fluorescent reporter, mouse lineage, expressing tdtomato, genotyping step
Funders Acknowledgements:
Aligning Science Across Parkinson's
Grant ID: ASAP-000525
Abstract
This protocol describes the generation of DATcrePink1 mice, either Pink1 KO, HET or WT and expressing the tdTomato fluorescent reporter selectively in dopaminergic neurons. It includes information on animal housing, mouse lineages used in the breeding strategy, and detailed genotyping steps.
Materials
1. DNA polymerase kit: KAPA2G Fast HotStart (Roche, Cat# KK7352)
2. Primers (Integrated DNA Technologies):
- Pink1 WT Forward: TCCCTCTATGGGCTCCTCTT
- Pink1 WT Reverse: GCAACTGCAAGGTCACTCA
- Pink1 KO Forward: GCACCCTGACCTTGGTTCTCTA
- Pink1 KO Reverse: GGGGGAACCTTCCTGACTAGG
3. MgCl2 Solution - 25 mM (Jena Bioscience, PCR-266-25)
4. DMSO (Sigma D-5879)
5. Agarose gel electrophoresis setup
6. Tris-borate-EDTA Buffer 10X (TBE) (Wisent, 880-545-CL)
7. Agarose (Wisent, 800-0150CG)
8. Ethidium Bromide Solution (BET), 10mg/ml, (Sigma, E1510-10ml)
9. Gel imager as Chemidoc (Biorad)
Obtain the following mouse lines:
- Pink1 KO (gift from Dr. Hansruedi Bueler)
- B6.SJL-Slc6a3tm1.1(cre)Bkmn/J (DATIREScre), (Jackson Laboratory, RRID: IMSR_JAX:006660)
- B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J (Ai9), (Jackson Laboratory, RRID: IMSR_JAX:007909)
Before start
Obtain the following mouse lines:
- Pink1 KO (gift from Dr. Hansruedi Bueler)
- B6.SJL-Slc6a3tm1.1(cre)Bkmn/J (DATIREScre), (Jackson Laboratory, RRID: IMSR_JAX:006660)
- B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J (Ai9), (Jackson Laboratory, RRID: IMSR_JAX:007909)
Purpose:
Generate mouse offsprings that are all DATIREScre/+; Ai9fl/+ and either Pink1 KO, HET or WT.
These mice are globally referred to as DATcrePink1 mice, which selectively express the red fluorescent protein tdTomato in dopaminergic neurons due to Cre-mediated recombination under control of the DAT promoter.
Animal housing details
Maintain all mice in a 12h light/dark cycle.
Control room temperature at 21°C.
Maintain relative humidity at 60%.
Provide ad libitum access to standard rodent chow and water.
Monitor health status daily.
Frame of reference
DATIREScre/cre = Homozygote mutant
DATIREScre/+ = Heterozygote
Ai9fl/fl = Homozygote mutant
Ai9fl/+= Heterozygote
Pink1-/- = Homozygote mutant (KO)
Pink1+/- = Heterozygote (HET)
Pink1+/+= Wild type (WT)
Breeding strategy
Step 1a: Cross DATIREScre with Pink1 mice
Purpose:
To generate DATIREScre/cre; Pink1+/− offsprings.
Method:
1. Mate DATIREScre/cre mice with Pink1-/- mice.
Genotype of all offsprings will be DATIREScre/+ ; Pink1+/-.
2. Mate these DATIREScre/+ ; Pink1+/- mice with DATIREScre/cre mice.
Genotype of 25% of the offsprings will be DATIREScre/cre ; Pink1+/-.
A third step involving the mating of DATIREScre/cre ; Pink1+/- mice to each other can be added to increase to 50% instead of 25% the proportion of mice with the DATIREScre/cre ; Pink1+/- genotype.
Step 1b (done in parallel with step 1a): Cross Ai9 mice with Pink1 mice
Purpose: To generate Ai9fl/fl ; Pink1+/- offsprings.
Method:
1. Mate Ai9fl/fl mice with Pink1-/- mice.
Genotype of all offsprings will be Ai9fl/+;Pink1+/-.
2. Mate these Ai9fl/+; Pink1+/- mice with Ai9fl/fl mice.
Genotype of 25% of the offsprings will be Ai9fl/fl; Pink1+/-.
A third step involving the mating of Ai9fl/fl; Pink1+/- mice to each other can be added to increase to 50% instead of 25% the proportion of mice with the Ai9fl/fl; Pink1+/- genotype.
Step 2: Cross DATIREScre/cre ; Pink1+/- mice with Ai9fl/fl; Pink1+/- mice.
Offsprings will all be DATIREScre/+ ; Ai9fl/+ and 25% of these will be Pink1 KO, 25% Pink1 WT and 50% Pink1 HET.
These mice are referred to as DATcrePink1 mice, which exhibit selective tdTomato fluorescence in dopaminergic neurons due to Cre-mediated recombination under control of the DAT promoter.
Genotyping protocol
41m
Procedure for DNA extraction from mouse tails:
1m
For one tail, pre-mix 88 µL of water, 2 µL of KAPAExpress Extract Enzyme and 10 µL of KAPAExpress Extract Buffer.
Mix thoroughly by vortexing.
Place in a 1.5 mL sterile microcentrifuge tube with 0.2 cm piece of tail tip.
Ensure that the tail is in the solution.
Incubate 00:10:00 at 75 °C (lysis),
then 00:05:00 at95 °C (enzyme inactivation).
15m
Setting up the PCR
General Reaction for one tail (25 µL total reaction)
4.5 µL water
12.5 µL KAPA2G Fast Genotyping Mix (final concentration 1X)
0.5 µL MgCl2 (25mM) (final concentration 2 millimolar (mM) )
1.25 µL Pink1 WT Forward primer 4 uM (final concentration 0.2 micromolar (µM) )
1.25 µL Pink1 WT Reverse primer 4 uM (final concentration 0.2 micromolar (µM) )
1.25 µL Pink1 KO Forward primer 4 uM (final concentration 0.2 micromolar (µM) )
1.25 µL Pink1 KO Reverse primer 4 uM (final concentration 0.2 micromolar (µM) )
1.5 µL DMSO (final concentration 6%)
1 µL DNA sample
PCR Program:
1=95°C for 5:00
2=95°C for 0:30
3=**61**°C for 0:30
4=72°C for 0:45
5=Go to 2, repeat 8x
6=95°C for 0:20
7=54°C for 0:20
8=72°C for 0:30
9=Go to 6, repeat 25x
10=72°C for 5.00
11=4°C forever
**Touch down PCR, -0.5°C per cycle**
Approximated time: 2h00
Gel:
Prepare a 1.5% agarose gel
- Mix 100 mL of TBE 0.5X + 1.5 g agarose powder in 500 mL glass Erlenmeyer
- Warm in a microwave for ~00:02:00 until you cannot see agarose particles
- Swirl every minute while heating.
- Add 7 µL BET (final concentration 0.7 µg/mL )
- Wait 00:20:00 for polymerization.
25m
Load the sample on the gel and run
Maximum voltage for this type of gel = 150V
Take an image with a gel imager
Expected band sizes:
Knock out : 450 bp
Wild type : 310 bp
Heterozygous : both
Example of a gel
Lanes:
1: Molecular weight ladder (fermentas, cat.# SM1153)
2 to 16: samples
17: Knock out control
18: Heterozygous control
19: Wild Type control
20: H20 control